MaxEntScan Visualizer

Analysis of 5' (Donor) and 3' (Acceptor) splice site mutations using MaxEntScan.

This tool is highly experimental. Results should be interpreted with caution and validated with additional methods.

Minimal length: 23 nucleotides; example: CTGCCATTGTCAGAGGTAAGTAGCCGTAGCTAGCTAG

What is MaxEntScan

MaxEntScan is a method for predicting sequence patterns of 5′ (Donor) and 3′ (Acceptor) splice sites based on the Maximum Entropy principle. It evaluates the probability that a given sequence functions as a splice site by considering dependencies between both adjacent and non-adjacent positions.

Result interpretation

The page displays two sequence comparisons: one for the Acceptor (3′ splice site) and one for the Donor (5′ splice site). For each sequence, the splice site strength (MaxEntScore) is shown below.

Higher MaxEntScore values indicate a greater probability that the sequence represents a functional Acceptor or Donor splice site.

Effect of sequence variants

Sequence variants may alter splice site motif strength. In particular, they can weaken or abolish an existing splice site or lead to the creation of a new (cryptic) splice site.

Comparing the reference and altered sequences helps assess the potential impact of a variant on splicing.

Method limitations

MaxEntScore is one of several tools used to estimate splice site strength. Results should be interpreted in conjunction with other bioinformatic methods and, when available, experimental evidence.

Disclaimer: This tool provides computational predictions intended for research use only. Results should be interpreted as theoretical estimates of splice site strength and must be validated through experimental methods (e.g., mini-gene assays or RNA-seq). These predictions are not suitable for clinical diagnostics. We use Java reimplementation of the original MaxEntScan algorithms developed by Yeo and Burge (2004) https://github.com/matthdsm/MaxEntScan. If you see differences between the results from this tool and the original Perl implementation, please report them.
For research and educational, non-commercial use only. Not for clinical or diagnostic use. GeneBe does not provide medical advice. Data use for AI modeling is prohibited: if used, the cost is $0.001 per byte of downloaded uncompressed data.