1-11806271-G-GTGCAGGGGGTCTCTGTGCTGCTGC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4

The NM_001286.5(CLCN6):​c.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG​(p.Gly6_Arg13dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 33)

Consequence

CLCN6
NM_001286.5 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 2.81
Variant links:
Genes affected
CLCN6 (HGNC:2024): (chloride voltage-gated channel 6) This gene encodes a member of the voltage-dependent chloride channel protein family. Members of this family can function as either chloride channels or antiporters. This protein is primarily localized to late endosomes and functions as a chloride/proton antiporter. Alternate splicing results in both coding and non-coding variants. Additional alternately spliced variants have been described but their full-length structure is unknown. [provided by RefSeq, Mar 2012]
MTHFR (HGNC:7436): (methylenetetrahydrofolate reductase) The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_001286.5.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CLCN6NM_001286.5 linkc.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG p.Gly6_Arg13dup conservative_inframe_insertion Exon 1 of 23 ENST00000346436.11 NP_001277.2 P51797-1
CLCN6NM_001256959.2 linkc.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG p.Gly6_Arg13dup conservative_inframe_insertion Exon 1 of 22 NP_001243888.2 P51797-6
CLCN6NR_046428.2 linkn.88_111dupGGGTCTCTGTGCTGCTGCTGCAGG non_coding_transcript_exon_variant Exon 1 of 23

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CLCN6ENST00000346436.11 linkc.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG p.Gly6_Arg13dup conservative_inframe_insertion Exon 1 of 23 1 NM_001286.5 ENSP00000234488.9 P51797-1

Frequencies

GnomAD3 genomes
Cov.:
33
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Oct 14, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant, c.16_39dup, results in the insertion of 8 amino acid(s) of the CLCN6 protein (p.Gly6_Arg13dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CLCN6-related conditions. ClinVar contains an entry for this variant (Variation ID: 1998501). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr1-11866328; API