1-11806271-G-GTGCAGGGGGTCTCTGTGCTGCTGC

Variant names:

• chr1-11806271-G-GTGCAGGGGGTCTCTGTGCTGCTGC
• NM_001286.5:c.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001286.5(CLCN6):​c.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG​(p.Gly6_Arg13dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: CLCN6 NM_001286.5 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.81
• Publications: 0 publications found

Genes affected

CLCN6 (HGNC:2024): (chloride voltage-gated channel 6) This gene encodes a member of the voltage-dependent chloride channel protein family. Members of this family can function as either chloride channels or antiporters. This protein is primarily localized to late endosomes and functions as a chloride/proton antiporter. Alternate splicing results in both coding and non-coding variants. Additional alternately spliced variants have been described but their full-length structure is unknown. [provided by RefSeq, Mar 2012]

MTHFR (HGNC:7436): (methylenetetrahydrofolate reductase) The protein encoded by this gene catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine. Genetic variation in this gene influences susceptibility to occlusive vascular disease, neural tube defects, colon cancer and acute leukemia, and mutations in this gene are associated with methylenetetrahydrofolate reductase deficiency.[provided by RefSeq, Oct 2009]

MTHFR Gene-Disease associations (from GenCC):

• homocystinuria due to methylene tetrahydrofolate reductase deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001286.5.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001286.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CLCN6	NM_001286.5	MANE Select	c.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG	p.Gly6_Arg13dup	conservative_inframe_insertion	Exon 1 of 23	NP_001277.2	P51797-1
	CLCN6	NM_001256959.2		c.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG	p.Gly6_Arg13dup	conservative_inframe_insertion	Exon 1 of 22	NP_001243888.2	P51797-6
	CLCN6	NR_046428.2		n.88_111dupGGGTCTCTGTGCTGCTGCTGCAGG		non_coding_transcript_exon	Exon 1 of 23

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CLCN6	ENST00000346436.11	TSL:1 MANE Select	c.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG	p.Gly6_Arg13dup	conservative_inframe_insertion	Exon 1 of 23	ENSP00000234488.9	P51797-1
	CLCN6	ENST00000376490.7	TSL:1	n.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG		non_coding_transcript_exon	Exon 1 of 11
	CLCN6	ENST00000376491.7	TSL:1	n.16_39dupGGGTCTCTGTGCTGCTGCTGCAGG		non_coding_transcript_exon	Exon 1 of 11

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr1-11866328;