1-208027270-GAGCTGCTCCACCTTATAAGCC-G

Variant names:

• chr1-208027270-GAGCTGCTCCACCTTATAAGCC-G
• NM_025179.4:c.5637_5657delGGCTTATAAGGTGGAGCAGCT

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP3

The NM_025179.4(PLXNA2):​c.5637_5657delGGCTTATAAGGTGGAGCAGCT​(p.Ala1880_Leu1886del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: PLXNA2 NM_025179.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 9.64

Genes affected

PLXNA2 (HGNC:9100): (plexin A2) This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_025179.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PLXNA2	NM_025179.4	c.5637_5657delGGCTTATAAGGTGGAGCAGCT	p.Ala1880_Leu1886del	disruptive_inframe_deletion	Exon 32 of 32	ENST00000367033.4	NP_079455.3
PLXNA2	XM_005273164.4	c.5877_5897delGGCTTATAAGGTGGAGCAGCT	p.Ala1960_Leu1966del	disruptive_inframe_deletion	Exon 33 of 33		XP_005273221.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PLXNA2	ENST00000367033.4	c.5637_5657delGGCTTATAAGGTGGAGCAGCT	p.Ala1880_Leu1886del	disruptive_inframe_deletion	Exon 32 of 32	1	NM_025179.4	ENSP00000356000.3
PLXNA2	ENST00000483048.1	n.1673_1693delGGCTTATAAGGTGGAGCAGCT		non_coding_transcript_exon_variant	Exon 3 of 3	1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

PLXNA2-related disorder Uncertain:1

Jun 13, 2024

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The PLXNA2 c.5637_5657del21 variant is predicted to result in an in-frame deletion (p.Ala1880_Leu1886del). To our knowledge, this variant has not been reported in the literature or in a large population database, indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr1-208200615;