1-20807419-T-TTGCTGCTCTCCCATTTGTAGAAGGC

Variant names:

• chr1-20807419-T-TTGCTGCTCTCCCATTTGTAGAAGGC
• NM_001391906.1:c.4801_4825dupGCCTTCTACAAATGGGAGAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_001391906.1(EIF4G3):​c.4801_4825dupGCCTTCTACAAATGGGAGAGCAGCA​(p.Lys1609SerfsTer39) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: EIF4G3 NM_001391906.1 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 5.05

Genes affected

EIF4G3 (HGNC:3298): (eukaryotic translation initiation factor 4 gamma 3) The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0205 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EIF4G3	NM_001391906.1	c.4801_4825dupGCCTTCTACAAATGGGAGAGCAGCA	p.Lys1609SerfsTer39	frameshift_variant	Exon 37 of 37	ENST00000602326.6	NP_001378835.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EIF4G3	ENST00000602326.6	c.4801_4825dupGCCTTCTACAAATGGGAGAGCAGCA	p.Lys1609SerfsTer39	frameshift_variant	Exon 37 of 37	1	NM_001391906.1	ENSP00000473510.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Heparin cofactor II deficiency Pathogenic:1

Apr 17, 2023

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr1-21133912;