1-209432291-T-TAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The ENST00000366437.8(MIR205HG):n.647_679dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000366437.8 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt | 
|---|---|---|---|---|---|---|---|---|
| MIR205HG | NR_145433.1  | n.593_625dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 3 of 3 | ||||
| MIR205HG | NR_145434.1  | n.728_760dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 5 of 5 | ||||
| MIR205HG | NR_145435.1  | n.676_708dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 4 of 4 | 
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt | 
|---|---|---|---|---|---|---|---|---|---|---|
| MIR205HG | ENST00000366437.8  | n.647_679dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 4 of 4 | 3 | |||||
| MIR205HG | ENST00000429156.7  | n.758_790dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 5 of 5 | 3 | |||||
| MIR205HG | ENST00000431096.7  | n.679_711dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | non_coding_transcript_exon_variant | Exon 4 of 4 | 3 | 
Frequencies
GnomAD3 genomes   AF:  0.0000201  AC: 3AN: 149472Hom.:  0  Cov.: 0 show subpopulations 
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF:  0.00000253  AC: 3AN: 1183548Hom.:  0  Cov.: 0 AF XY:  0.00000171  AC XY: 1AN XY: 585122 show subpopulations 
GnomAD4 genome   AF:  0.0000201  AC: 3AN: 149472Hom.:  0  Cov.: 0 AF XY:  0.0000137  AC XY: 1AN XY: 72848 show subpopulations 
ClinVar
Not reported inComputational scores
Source: 
Splicing
 Find out detailed SpliceAI scores and Pangolin per-transcript scores at