1-209432291-TAGCAGCAGCAGCAGCAGCAGCAGCAGC-TAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr1-209432291-T-TAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC
• rs3842530
• ENST00000366437.8:n.650_679dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000366437.8(MIR205HG):​n.650_679dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 0)
  • Exomes 𝑓: 8.4e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MIR205HG ENST00000366437.8 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00
• Publications: 10 publications found

Genes affected

MIR205HG (HGNC:43562): (MIR205 host gene)

MIR205 (HGNC:31583): (microRNA 205) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MIR205HG	NR_145433.1	n.596_625dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon_variant	Exon 3 of 3
MIR205HG	NR_145434.1	n.731_760dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon_variant	Exon 5 of 5
MIR205HG	NR_145435.1	n.679_708dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon_variant	Exon 4 of 4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MIR205HG	ENST00000366437.8	n.650_679dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon_variant	Exon 4 of 4	3
MIR205HG	ENST00000429156.7	n.761_790dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon_variant	Exon 5 of 5	3
MIR205HG	ENST00000431096.7	n.682_711dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon_variant	Exon 4 of 4	3

Frequencies

GnomAD3 genomes AF: 0.0000134 AC: 2 AN: 149472 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000498

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 8.45e-7 AC: 1 AN: 1183546 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 585122

African (AFR) AF: 0.0000386 AC: 1 AN: 25902

American (AMR) AF: 0.00 AC: 0 AN: 34060

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16278

East Asian (EAS) AF: 0.00 AC: 0 AN: 16402

South Asian (SAS) AF: 0.00 AC: 0 AN: 81278

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 30016

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4160

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 932548

Other (OTH) AF: 0.00 AC: 0 AN: 42902

GnomAD4 genome AF: 0.0000134 AC: 2 AN: 149472 Hom.: 0 Cov.: 0 AF XY: 0.0000275 AC XY: 2 AN XY: 72848

African (AFR) AF: 0.0000498 AC: 2 AN: 40162

American (AMR) AF: 0.00 AC: 0 AN: 15026

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.00 AC: 0 AN: 5046

South Asian (SAS) AF: 0.00 AC: 0 AN: 4636

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10334

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67540

Other (OTH) AF: 0.00 AC: 0 AN: 2058

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3842530; hg19: chr1-209605636;