1-225519331-ATCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGC-ATCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGC

Variant names:

• chr1-225519331-A-ATCCAGGCGTTCCTGCCGC
• rs71170086
• NM_018212.6:c.651_668dupGCGGCAGGAACGCCTGGA

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 2P and 8B. PM4 BS1 BS2

The NM_018212.6(ENAH):​c.651_668dupGCGGCAGGAACGCCTGGA​(p.Glu217_Leu222dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00543 in 1,610,322 control chromosomes in the GnomAD database, including 162 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0094 (25 hom., cov: 31)
  • Exomes 𝑓: 0.0050 (137 hom.)
• Consequence: ENAH NM_018212.6 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.04
• Publications: 5 publications found

Genes affected

ENAH (HGNC:18271): (ENAH actin regulator) This gene encodes a member of the enabled/ vasodilator-stimulated phosphoprotein. Members of this gene family are involved in actin-based motility. This protein is involved in regulating the assembly of actin filaments and modulates cell adhesion and motility. Alternate splice variants of this gene have been correlated with tumor invasiveness in certain tissues and these variants may serve as prognostic markers. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2016]

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_018212.6.
• BS1: Variant frequency is greater than expected in population eas. GnomAd4 allele frequency = 0.00945 (1410/149242) while in subpopulation EAS AF = 0.0451 (223/4948). AF 95% confidence interval is 0.0402. There are 25 homozygotes in GnomAd4. There are 709 alleles in the male GnomAd4 subpopulation. Median coverage is 31. This position passed quality control check.
• BS2: High AC in GnomAd4 at 1410 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_018212.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ENAH	NM_018212.6	MANE Select	c.651_668dupGCGGCAGGAACGCCTGGA	p.Glu217_Leu222dup	disruptive_inframe_insertion	Exon 5 of 14	NP_060682.2
	ENAH	NM_001420159.1		c.708_725dupGCGGCAGGAACGCCTGGA	p.Glu236_Leu241dup	disruptive_inframe_insertion	Exon 6 of 16	NP_001407088.1
	ENAH	NM_001420160.1		c.651_668dupGCGGCAGGAACGCCTGGA	p.Glu217_Leu222dup	disruptive_inframe_insertion	Exon 5 of 15	NP_001407089.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ENAH	ENST00000366843.7	TSL:1 MANE Select	c.651_668dupGCGGCAGGAACGCCTGGA	p.Glu217_Leu222dup	disruptive_inframe_insertion	Exon 5 of 14	ENSP00000355808.2	Q8N8S7-2
	ENAH	ENST00000366844.7	TSL:1	c.651_668dupGCGGCAGGAACGCCTGGA	p.Glu217_Leu222dup	disruptive_inframe_insertion	Exon 5 of 15	ENSP00000355809.2	Q8N8S7-1
	ENAH	ENST00000497899.6	TSL:1	c.501_518dupGCGGCAGGAACGCCTGGA	p.Glu167_Leu172dup	disruptive_inframe_insertion	Exon 4 of 4	ENSP00000489106.1	A0A0U1RQP7

Frequencies

GnomAD3 genomes AF: 0.00941 AC: 1404 AN: 149148 Hom.: 25 Cov.: 31

Gnomad AFR AF: 0.0112

Gnomad AMI AF: 0.00221

Gnomad AMR AF: 0.00685

Gnomad ASJ AF: 0.0153

Gnomad EAS AF: 0.0450

Gnomad SAS AF: 0.0245

Gnomad FIN AF: 0.00566

Gnomad MID AF: 0.00962

Gnomad NFE AF: 0.00559

Gnomad OTH AF: 0.0118

GnomAD2 exomes AF: 0.00694 AC: 1737 AN: 250234 AF XY: 0.00678

Gnomad AFR exome AF: 0.00667

Gnomad AMR exome AF: 0.00463

Gnomad ASJ exome AF: 0.00418

Gnomad EAS exome AF: 0.0410

Gnomad FIN exome AF: 0.00183

Gnomad NFE exome AF: 0.00205

Gnomad OTH exome AF: 0.00589

GnomAD4 exome AF: 0.00501 AC: 7327 AN: 1461080 Hom.: 137 Cov.: 30 AF XY: 0.00590 AC XY: 4292 AN XY: 726894

African (AFR) AF: 0.00559 AC: 187 AN: 33434

American (AMR) AF: 0.00425 AC: 190 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.0111 AC: 289 AN: 26128

East Asian (EAS) AF: 0.0371 AC: 1473 AN: 39682

South Asian (SAS) AF: 0.0247 AC: 2128 AN: 86152

European-Finnish (FIN) AF: 0.00668 AC: 356 AN: 53298

Middle Eastern (MID) AF: 0.00869 AC: 50 AN: 5756

European-Non Finnish (NFE) AF: 0.00208 AC: 2309 AN: 1111558

Other (OTH) AF: 0.00572 AC: 345 AN: 60356

GnomAD4 genome AF: 0.00945 AC: 1410 AN: 149242 Hom.: 25 Cov.: 31 AF XY: 0.00974 AC XY: 709 AN XY: 72766

African (AFR) AF: 0.0113 AC: 459 AN: 40530

American (AMR) AF: 0.00684 AC: 103 AN: 15054

Ashkenazi Jewish (ASJ) AF: 0.0153 AC: 52 AN: 3400

East Asian (EAS) AF: 0.0451 AC: 223 AN: 4948

South Asian (SAS) AF: 0.0243 AC: 111 AN: 4562

European-Finnish (FIN) AF: 0.00566 AC: 58 AN: 10254

Middle Eastern (MID) AF: 0.00345 AC: 1 AN: 290

European-Non Finnish (NFE) AF: 0.00559 AC: 376 AN: 67244

Other (OTH) AF: 0.0122 AC: 25 AN: 2056

Alfa AF: 0.00370 Hom.: 111

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=67/33	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71170086; hg19: chr1-225707033;