1-22659292-AGATGGATGGATGGATGGATG-A

Variant names:

• chr1-22659292-AGATGGATGGATGGATGGATG-A
• rs56917855
• NM_001378156.1:c.-23-131_-23-112delGATGGATGGATGGATGGATG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_001378156.1(C1QB):​c.-23-131_-23-112delGATGGATGGATGGATGGATG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000193 in 519,336 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000019 (0 hom.)
• Consequence: C1QB NM_001378156.1 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.22
• Publications: 0 publications found

Genes affected

C1QB (HGNC:1242): (complement C1q B chain) This gene encodes the B-chain polypeptide of serum complement subcomponent C1q, which associates with C1r and C1s to yield the first component of the serum complement system. C1q is composed of 18 polypeptide chains which include 6 A-chains, 6 B-chains, and 6 C-chains. Each chain contains an N-terminal collagen-like region and a C-terminal C1q globular domain. C1q deficiency is associated with lupus erythematosus and glomerulonephritis. [provided by RefSeq, Dec 2016]

C1QB Gene-Disease associations (from GenCC):

• C1Q deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Labcorp Genetics (formerly Invitae)

ENSG00000308848 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
C1QB	NM_001378156.1	c.-23-131_-23-112delGATGGATGGATGGATGGATG		intron_variant	Intron 1 of 2	ENST00000509305.6	NP_001365085.1
C1QB	NM_000491.5	c.-17-131_-17-112delGATGGATGGATGGATGGATG		intron_variant	Intron 1 of 2		NP_000482.3
C1QB	NM_001371184.3	c.-23-131_-23-112delGATGGATGGATGGATGGATG		intron_variant	Intron 2 of 3		NP_001358113.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
C1QB	ENST00000509305.6	c.-23-147_-23-128delGATGGATGGATGGATGGATG		intron_variant	Intron 1 of 2	1	NM_001378156.1	ENSP00000423689.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 0.00000193 AC: 1 AN: 519336 Hom.: 0 AF XY: 0.00000365 AC XY: 1 AN XY: 273720

African (AFR) AF: 0.00 AC: 0 AN: 14198

American (AMR) AF: 0.00 AC: 0 AN: 26996

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16072

East Asian (EAS) AF: 0.00 AC: 0 AN: 26014

South Asian (SAS) AF: 0.00 AC: 0 AN: 49896

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 37198

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2158

European-Non Finnish (NFE) AF: 0.00000314 AC: 1 AN: 318610

Other (OTH) AF: 0.00 AC: 0 AN: 28194

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs56917855; hg19: chr1-22985785;