10-11165651-G-GGACCGGAGTCAGAACCCTCCGC

Variant names:

• chr10-11165651-G-GGACCGGAGTCAGAACCCTCCGC
• NM_001326342.2:c.241_262dupGACCGGAGTCAGAACCCTCCGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001326342.2(CELF2):​c.241_262dupGACCGGAGTCAGAACCCTCCGC​(p.Gln88ArgfsTer10) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CELF2 NM_001326342.2 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.83
• Publications: 0 publications found

Genes affected

CELF2 (HGNC:2550): (CUGBP Elav-like family member 2) Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

CELF2 Gene-Disease associations (from GenCC):

• developmental and epileptic encephalopathy 97

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• undetermined early-onset epileptic encephalopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• complex neurodevelopmental disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 10-11165651-G-GGACCGGAGTCAGAACCCTCCGC is Pathogenic according to our data. Variant chr10-11165651-G-GGACCGGAGTCAGAACCCTCCGC is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3375484.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CELF2	NM_001326342.2	c.241_262dupGACCGGAGTCAGAACCCTCCGC	p.Gln88ArgfsTer10	frameshift_variant	Exon 2 of 13	ENST00000633077.2	NP_001313271.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CELF2	ENST00000633077.2	c.241_262dupGACCGGAGTCAGAACCCTCCGC	p.Gln88ArgfsTer10	frameshift_variant	Exon 2 of 13	1	NM_001326342.2	ENSP00000488690.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Developmental and epileptic encephalopathy 97 Pathogenic:1

Sep 23, 2024

Equipe Genetique des Anomalies du Developpement, Université de Bourgogne

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.241_262dup p.(Gln88Argfs*10) variant is a 21 bp duplication at position 241_262,predicted to result in a frameshift and premature stop codon after 10 aa. It likely results in an absent or disrupted protein product. Missense or nonsense variants of CELF2 are reported in an autosomal dominant developmental epileptic encephalopathy (OMIM #619561 ) (PMID 34107259, 33131106). This variant is not present in population database gnomAD (v4.1.0). It has not been reported in ClinVar. It has not been reported in literature. Based on the evidence outlined above, the variant was classified as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr10-11207614;