10-12069109-ACCGAGCGGGGCGTTTACGGCTACCGGCCGAGGAAGCCCGAGAGCCGCGAG-A

Variant names:

• chr10-12069109-ACCGAGCGGGGCGTTTACGGCTACCGGCCGAGGAAGCCCGAGAGCCGCGAG-A
• rs779758367
• NM_018706.7:c.79_128delGAGCGGGGCGTTTACGGCTACCGGCCGAGGAAGCCCGAGAGCCGCGAGCC

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PVS1_Strong PP5

The NM_018706.7(DHTKD1):​c.79_128delGAGCGGGGCGTTTACGGCTACCGGCCGAGGAAGCCCGAGAGCCGCGAGCC​(p.Glu27ProfsTer10) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000137 in 1,610,776 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000092 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000055 (0 hom.)
• Consequence: DHTKD1 NM_018706.7 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1
• Conservation: PhyloP100: 3.07

Genes affected

DHTKD1 (HGNC:23537): (dehydrogenase E1 and transketolase domain containing 1) This gene encodes a component of a mitochondrial 2-oxoglutarate-dehydrogenase-complex-like protein involved in the degradation pathways of several amino acids, including lysine. Mutations in this gene are associated with 2-aminoadipic 2-oxoadipic aciduria and Charcot-Marie-Tooth Disease Type 2Q. [provided by RefSeq, May 2013]

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 7 pathogenic variants in the truncated region.
• PP5: Variant 10-12069109-ACCGAGCGGGGCGTTTACGGCTACCGGCCGAGGAAGCCCGAGAGCCGCGAG-A is Pathogenic according to our data. Variant chr10-12069109-ACCGAGCGGGGCGTTTACGGCTACCGGCCGAGGAAGCCCGAGAGCCGCGAG-A is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 2504734.We mark this variant Likely_pathogenic, oryginal submissions are: {Uncertain_significance=1, Pathogenic=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DHTKD1	NM_018706.7	c.79_128delGAGCGGGGCGTTTACGGCTACCGGCCGAGGAAGCCCGAGAGCCGCGAGCC	p.Glu27ProfsTer10	frameshift_variant	Exon 1 of 17	ENST00000263035.9	NP_061176.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DHTKD1	ENST00000263035.9	c.79_128delGAGCGGGGCGTTTACGGCTACCGGCCGAGGAAGCCCGAGAGCCGCGAGCC	p.Glu27ProfsTer10	frameshift_variant	Exon 1 of 17	1	NM_018706.7	ENSP00000263035.4
DHTKD1	ENST00000437298.1	c.79_128delGAGCGGGGCGTTTACGGCTACCGGCCGAGGAAGCCCGAGAGCCGCGAGCC	p.Glu27ProfsTer10	frameshift_variant	Exon 1 of 5	3		ENSP00000388163.1

Frequencies

GnomAD3 genomes AF: 0.0000921 AC: 14 AN: 152082 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000290

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.000479

GnomAD3 exomes AF: 0.0000167 AC: 4 AN: 239308 Hom.: 0 AF XY: 0.0000152 AC XY: 2 AN XY: 131208

Gnomad AFR exome AF: 0.000208

Gnomad AMR exome AF: 0.0000294

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000548 AC: 8 AN: 1458694 Hom.: 0 AF XY: 0.00000551 AC XY: 4 AN XY: 725544

Gnomad4 AFR exome AF: 0.0000900

Gnomad4 AMR exome AF: 0.0000449

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.0000499

GnomAD4 genome AF: 0.0000921 AC: 14 AN: 152082 Hom.: 0 Cov.: 32 AF XY: 0.0000808 AC XY: 6 AN XY: 74298

Gnomad4 AFR AF: 0.000290

Gnomad4 AMR AF: 0.0000655

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.000479

Alfa AF: 0.000169 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

2-aminoadipic 2-oxoadipic aciduria Pathogenic:1

Jul 15, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Glu27Profs*10) in the DHTKD1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in DHTKD1 are known to be pathogenic (PMID: 23141293, 25860818). This variant is present in population databases (rs779758367, gnomAD 0.02%). This variant has not been reported in the literature in individuals affected with DHTKD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 2504734). For these reasons, this variant has been classified as Pathogenic. -

not provided Uncertain:1

Dec 05, 2022

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs779758367; hg19: chr10-12111108;