11-118436594-GGGGGCGCCCCGCGGCAACGCGTCCCGGCCCTGCTGCTTCCCCCCGGGCCCCCGGTCGGCGGTGGCGGCCCC-G

Variant names:

• chr11-118436594-GGGGGCGCCCCGCGGCAACGCGTCCCGGCCCTGCTGCTTCCCCCCGGGCCCCCGGTCGGCGGTGGCGGCCCC-G
• rs2134152451
• NM_001197104.2:c.93_163delGCGGCAACGCGTCCCGGCCCTGCTGCTTCCCCCCGGGCCCCCGGTCGGCGGTGGCGGCCCCGGGGCGCCCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001197104.2(KMT2A):​c.93_163delGCGGCAACGCGTCCCGGCCCTGCTGCTTCCCCCCGGGCCCCCGGTCGGCGGTGGCGGCCCCGGGGCGCCCC​(p.Arg32LeufsTer91) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P31P) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: KMT2A NM_001197104.2 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.13
• Publications: 0 publications found

Genes affected

KMT2A (HGNC:7132): (lysine methyltransferase 2A) This gene encodes a transcriptional coactivator that plays an essential role in regulating gene expression during early development and hematopoiesis. The encoded protein contains multiple conserved functional domains. One of these domains, the SET domain, is responsible for its histone H3 lysine 4 (H3K4) methyltransferase activity which mediates chromatin modifications associated with epigenetic transcriptional activation. This protein is processed by the enzyme Taspase 1 into two fragments, MLL-C and MLL-N. These fragments reassociate and further assemble into different multiprotein complexes that regulate the transcription of specific target genes, including many of the HOX genes. Multiple chromosomal translocations involving this gene are the cause of certain acute lymphoid leukemias and acute myeloid leukemias. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]

KMT2A Gene-Disease associations (from GenCC):

• Wiedemann-Steiner syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Illumina, Labcorp Genetics (formerly Invitae), ClinGen

ENSG00000285827 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 447 pathogenic variants in the truncated region.
• PP5: Variant 11-118436594-GGGGGCGCCCCGCGGCAACGCGTCCCGGCCCTGCTGCTTCCCCCCGGGCCCCCGGTCGGCGGTGGCGGCCCC-G is Pathogenic according to our data. Variant chr11-118436594-GGGGGCGCCCCGCGGCAACGCGTCCCGGCCCTGCTGCTTCCCCCCGGGCCCCCGGTCGGCGGTGGCGGCCCC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1298527.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KMT2A	NM_001197104.2	c.93_163delGCGGCAACGCGTCCCGGCCCTGCTGCTTCCCCCCGGGCCCCCGGTCGGCGGTGGCGGCCCCGGGGCGCCCC	p.Arg32LeufsTer91	frameshift_variant	Exon 1 of 36	ENST00000534358.8	NP_001184033.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KMT2A	ENST00000534358.8	c.93_163delGCGGCAACGCGTCCCGGCCCTGCTGCTTCCCCCCGGGCCCCCGGTCGGCGGTGGCGGCCCCGGGGCGCCCC	p.Arg32LeufsTer91	frameshift_variant	Exon 1 of 36	1	NM_001197104.2	ENSP00000436786.2
ENSG00000285827	ENST00000648261.1	c.-798-32170_-798-32100delGCGGCAACGCGTCCCGGCCCTGCTGCTTCCCCCCGGGCCCCCGGTCGGCGGTGGCGGCCCCGGGGCGCCCC		intron_variant	Intron 1 of 6			ENSP00000498126.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Aug 01, 2021

CeGaT Center for Human Genetics Tuebingen

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2134152451; hg19: chr11-118307309;