11-126343404-TCCACCAGGGGCAGGTGAGTGGCTTCACCAAA-T

Variant names:

• chr11-126343404-TCCACCAGGGGCAGGTGAGTGGCTTCACCAAA-T
• rs768959171
• NM_014026.6:c.739_747+22delCAGGGGCAGGTGAGTGGCTTCACCAAACCAC

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_014026.6(DCPS):​c.739_747+22delCAGGGGCAGGTGAGTGGCTTCACCAAACCAC​(p.Gln247_Gln249del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000137 in 1,461,082 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000014 (0 hom.)
• Consequence: DCPS NM_014026.6 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.93

Genes affected

DCPS (HGNC:29812): (decapping enzyme, scavenger) This gene encodes a member of the histidine triad family of pyrophosphatases that removes short mRNA fragments containing the 5′ mRNA cap structure, which appear in the 3′ → 5′ mRNA decay pathway, following deadenylation and exosome-mediated turnover. This enzyme hydrolyzes the triphosphate linkage of the cap structure (7-methylguanosine nucleoside triphosphate) to yield 7-methylguanosine monophosphate and nucleoside diphosphate. It protects the cell from the potentially toxic accumulation of these short, capped mRNA fragments, and regulates the activity of other cap-binding proteins, which are inhibited by their accumulation. It also acts as a transcript-specific modulator of pre-mRNA splicing and microRNA turnover. [provided by RefSeq, Apr 2017]

GSEC (HGNC:48645): (G-quadruplex forming sequence containing lncRNA)

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.109467454 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DCPS	NM_014026.6	c.739_747+22delCAGGGGCAGGTGAGTGGCTTCACCAAACCAC	p.Gln247_Gln249del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 5 of 6	ENST00000263579.5	NP_054745.1
DCPS	NM_001350236.2	c.760_768+22delCAGGGGCAGGTGAGTGGCTTCACCAAACCAC	p.Gln254_Gln256del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 5 of 6		NP_001337165.1
GSEC	NR_033839.1	n.147-1113_147-1083delTTTGGTGAAGCCACTCACCTGCCCCTGGTGG		intron_variant	Intron 1 of 1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DCPS	ENST00000263579.5	c.735_747+18delCCACCAGGGGCAGGTGAGTGGCTTCACCAAA	p.His246ThrfsTer3	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 5 of 6	1	NM_014026.6	ENSP00000263579.4

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD3 exomes AF: 0.00000401 AC: 1 AN: 249306 Hom.: 0 AF XY: 0.00000742 AC XY: 1 AN XY: 134856

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000888

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000137 AC: 2 AN: 1461082 Hom.: 0 AF XY: 0.00000275 AC XY: 2 AN XY: 726788

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000180

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Jun 06, 2024

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: DCPS c.739_747+22del31 is located in an intron/exon junction region and is predicted to destroy the canonical splice-site in intron 5, thus may affect mRNA splicing resulting in a significantly altered protein due to either exon skipping, shortening, or inclusion of intronic material; several amino acids in exon 5 may also be disrupted. However, no evidence, such as pathogenic variant(s) within the last exon, pathogenic variant(s) at same donor splice-site, has been identifed to support the pathogeneicity of this varaint. Several computational tools predict a significant impact on normal splicing: Four predict the variant abolishes the canonical 5' splicing donor site. However, these predictions have yet to be confirmed by functional studies. The variant allele was found at a frequency of 4e-06 in 249306 control chromosomes. To our knowledge, no occurrence of c.739_747+22del31 in individuals affected with Al-Raqad Syndrome and no experimental evidence demonstrating its impact on protein function have been reported. No submitters have cited clinical-significance assessments for this variant to ClinVar. Based on the evidence outlined above, the variant was classified as uncertain significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs768959171; hg19: chr11-126213299;