11-61835023-TC-TCCTCCCTGCCTCCCCAGGGACT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_004265.4(FADS2):c.208-2753_208-2733dupCTCCCTGCCTCCCCAGGGACT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_004265.4 intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004265.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FADS2 | MANE Select | c.208-2753_208-2733dupCTCCCTGCCTCCCCAGGGACT | intron | N/A | NP_004256.1 | O95864-1 | |||
| FADS2 | c.142-2753_142-2733dupCTCCCTGCCTCCCCAGGGACT | intron | N/A | NP_001268430.1 | O95864-2 | ||||
| FADS2 | c.115-2753_115-2733dupCTCCCTGCCTCCCCAGGGACT | intron | N/A | NP_001268431.1 | O95864-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FADS2 | TSL:1 MANE Select | c.208-2754_208-2753insCTCCCTGCCTCCCCAGGGACT | intron | N/A | ENSP00000278840.4 | O95864-1 | |||
| FADS2 | TSL:1 | c.142-2754_142-2753insCTCCCTGCCTCCCCAGGGACT | intron | N/A | ENSP00000257261.6 | O95864-2 | |||
| FADS2 | TSL:1 | c.208-2754_208-2753insCTCCCTGCCTCCCCAGGGACT | intron | N/A | ENSP00000431091.1 | O95864-3 |
Frequencies
GnomAD3 genomes Cov.: 0
GnomAD4 genome Cov.: 0
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.