12-100291538-TGACAAGTATCAAAAATTTGAA-T

Variant names:

• chr12-100291538-TGACAAGTATCAAAAATTTGAA-T
• NM_017988.6:c.214_234delGACAAGTATCAAAAATTTGAA

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM2 PM4 PP3 PP5_Moderate

The NM_017988.6(SCYL2):​c.214_234delGACAAGTATCAAAAATTTGAA​(p.Asp72_Glu78del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SCYL2 NM_017988.6 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 10.0

Genes affected

SCYL2 (HGNC:19286): (SCY1 like pseudokinase 2) The protein encoded by this gene associates with clathrin-coated complexes at the plasma membrane and with endocytic coated vesicles. The encoded protein phosphorylates the beta2 subunit of the plasma membrane adapter complex AP2 and interacts with clathrin, showing involvement in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. In addition, this protein has a role in the Wnt signaling pathway by targeting frizzled 5 (Fzd5) for lysosomal degradation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_017988.6.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 12-100291538-TGACAAGTATCAAAAATTTGAA-T is Pathogenic according to our data. Variant chr12-100291538-TGACAAGTATCAAAAATTTGAA-T is described in ClinVar as [Pathogenic]. Clinvar id is 2445467.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SCYL2	NM_017988.6	c.214_234delGACAAGTATCAAAAATTTGAA	p.Asp72_Glu78del	conservative_inframe_deletion	Exon 3 of 18	ENST00000360820.7	NP_060458.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SCYL2	ENST00000360820.7	c.214_234delGACAAGTATCAAAAATTTGAA	p.Asp72_Glu78del	conservative_inframe_deletion	Exon 3 of 18	1	NM_017988.6	ENSP00000354061.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Arthrogryposis multiplex congenita 4, neurogenic, with agenesis of the corpus callosum Pathogenic:1

Jan 01, 2021

Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

A homozygous deletion in exon 3 of the SCYL2 gene that results in a frameshift and premature truncation of the protein, 9 amino acids downstream to codon 72 was detected. The variant c.214_234del (p.Asp72SerfsTer9) has not been reported in the 1000 genomes and gnomAD databases. The reference region is conserved across species. In summary, the variant meets our criteria to be classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr12-100685316;