12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCAGCA-CGCAGCA

Variant names:

• chr12-102958393-CGCAGCAGCAGCAGCAGCAGCA-C
• rs3832799
• NM_004316.4:c.166_186delCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP6_Moderate BS2

The NM_004316.4(ASCL1):​c.166_186delCAGCAGCAGCAGCAGCAGCAG​(p.Gln56_Gln62del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00191 in 1,507,080 control chromosomes in the GnomAD database, including 7 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.0017 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0019 (7 hom.)
• Consequence: ASCL1 NM_004316.4 conservative_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.809
• Publications: 15 publications found

Genes affected

ASCL1 (HGNC:738): (achaete-scute family bHLH transcription factor 1) This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]

PAH (HGNC:8582): (phenylalanine hydroxylase) This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase protein family. The encoded phenylalanine hydroxylase enzyme hydroxylates phenylalanine to tyrosine and is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Aug 2017]

PAH Gene-Disease associations (from GenCC):

• phenylketonuria

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
• classic phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• maternal phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild hyperphenylalaninemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• BP6: Variant 12-102958393-CGCAGCAGCAGCAGCAGCAGCA-C is Benign according to our data. Variant chr12-102958393-CGCAGCAGCAGCAGCAGCAGCA-C is described in ClinVar as [Likely_benign]. Clinvar id is 3910987.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAdExome4 at 7 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ASCL1	NM_004316.4	c.166_186delCAGCAGCAGCAGCAGCAGCAG	p.Gln56_Gln62del	conservative_inframe_deletion	Exon 1 of 2	ENST00000266744.4	NP_004307.2
PAH		n.102958414_102958394delTGCTGCTGCTGCTGCTGCTGC		bidirectional_gene_fusion
PAH	NM_001354304.2	c.-315_-295delTGCTGCTGCTGCTGCTGCTGC		5_prime_UTR_variant	Exon 1 of 14		NP_001341233.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ASCL1	ENST00000266744.4	c.166_186delCAGCAGCAGCAGCAGCAGCAG	p.Gln56_Gln62del	conservative_inframe_deletion	Exon 1 of 2	1	NM_004316.4	ENSP00000266744.3

Frequencies

GnomAD3 genomes AF: 0.00172 AC: 258 AN: 150116 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000758

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000595

Gnomad ASJ AF: 0.000579

Gnomad EAS AF: 0.000197

Gnomad SAS AF: 0.00399

Gnomad FIN AF: 0.00217

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00254

Gnomad OTH AF: 0.00146

GnomAD4 exome AF: 0.00193 AC: 2614 AN: 1356874 Hom.: 7 AF XY: 0.00196 AC XY: 1314 AN XY: 669192

African (AFR) AF: 0.000456 AC: 13 AN: 28512

American (AMR) AF: 0.000445 AC: 15 AN: 33680

Ashkenazi Jewish (ASJ) AF: 0.000416 AC: 10 AN: 24016

East Asian (EAS) AF: 0.0000300 AC: 1 AN: 33382

South Asian (SAS) AF: 0.00312 AC: 237 AN: 75982

European-Finnish (FIN) AF: 0.00306 AC: 126 AN: 41210

Middle Eastern (MID) AF: 0.00196 AC: 8 AN: 4084

European-Non Finnish (NFE) AF: 0.00199 AC: 2113 AN: 1059542

Other (OTH) AF: 0.00161 AC: 91 AN: 56466

GnomAD4 genome AF: 0.00172 AC: 258 AN: 150206 Hom.: 0 Cov.: 0 AF XY: 0.00162 AC XY: 119 AN XY: 73324

African (AFR) AF: 0.000756 AC: 31 AN: 40994

American (AMR) AF: 0.000594 AC: 9 AN: 15154

Ashkenazi Jewish (ASJ) AF: 0.000579 AC: 2 AN: 3456

East Asian (EAS) AF: 0.000198 AC: 1 AN: 5052

South Asian (SAS) AF: 0.00399 AC: 19 AN: 4760

European-Finnish (FIN) AF: 0.00217 AC: 22 AN: 10154

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.00254 AC: 171 AN: 67372

Other (OTH) AF: 0.00145 AC: 3 AN: 2072

Alfa AF: 0.00117 Hom.: 277

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

Feb 16, 2025

Laboratory of Genetics, Children's Clinical University Hospital Latvia

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.81
Mutation Taster		=143/57	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3832799; hg19: chr12-103352171;