12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCAGCA-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2
The NM_004316.4(ASCL1):c.166_186dupCAGCAGCAGCAGCAGCAGCAG(p.Gln56_Gln62dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (no stars).
Frequency
Consequence
NM_004316.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ASCL1 | NM_004316.4 | c.166_186dupCAGCAGCAGCAGCAGCAGCAG | p.Gln56_Gln62dup | conservative_inframe_insertion | Exon 1 of 2 | ENST00000266744.4 | NP_004307.2 | |
PAH | NM_001354304.2 | c.-315_-295dupTGCTGCTGCTGCTGCTGCTGC | 5_prime_UTR_variant | Exon 1 of 14 | NP_001341233.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
ASCL1 | ENST00000266744.4 | c.166_186dupCAGCAGCAGCAGCAGCAGCAG | p.Gln56_Gln62dup | conservative_inframe_insertion | Exon 1 of 2 | 1 | NM_004316.4 | ENSP00000266744.3 | ||
PAH | ENST00000547319.1 | n.-4_17dupTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_exon_variant | Exon 1 of 3 | 4 | |||||
PAH | ENST00000551337.5 | c.-315_-295dupTGCTGCTGCTGCTGCTGCTGC | upstream_gene_variant | 3 | ENSP00000447620.1 | |||||
PAH | ENST00000635500.1 | n.-192_-172dupTGCTGCTGCTGCTGCTGCTGC | upstream_gene_variant | 3 |
Frequencies
GnomAD3 genomes AF: 0.000779 AC: 117AN: 150120Hom.: 0 Cov.: 0
GnomAD4 exome AF: 0.000119 AC: 162AN: 1356934Hom.: 0 Cov.: 17 AF XY: 0.000118 AC XY: 79AN XY: 669230
GnomAD4 genome AF: 0.000779 AC: 117AN: 150210Hom.: 0 Cov.: 0 AF XY: 0.000791 AC XY: 58AN XY: 73326
ClinVar
Submissions by phenotype
ASCL1-related disorder Uncertain:1
The ASCL1 c.166_186dup21 variant is predicted to result in an in-frame duplication (p.Gln56_Gln62dup). To our knowledge, this variant has not been reported in the literature or in a large population database, indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at