12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCAGCA-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr12-102958393-C-CGCAGCAGCAGCAGCAGCAGCA
• rs3832799
• NM_004316.4:c.166_186dupCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_004316.4(ASCL1):​c.166_186dupCAGCAGCAGCAGCAGCAGCAG​(p.Gln56_Gln62dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency:
  • Genomes: 𝑓 0.00078 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00012 (0 hom.)
• Consequence: ASCL1 NM_004316.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 0.219
• Publications: 15 publications found

Genes affected

ASCL1 (HGNC:738): (achaete-scute family bHLH transcription factor 1) This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]

PAH (HGNC:8582): (phenylalanine hydroxylase) This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase protein family. The encoded phenylalanine hydroxylase enzyme hydroxylates phenylalanine to tyrosine and is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Aug 2017]

PAH Gene-Disease associations (from GenCC):

• phenylketonuria

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
• classic phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• maternal phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild hyperphenylalaninemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ASCL1	NM_004316.4	c.166_186dupCAGCAGCAGCAGCAGCAGCAG	p.Gln56_Gln62dup	conservative_inframe_insertion	Exon 1 of 2	ENST00000266744.4	NP_004307.2
PAH	NM_001354304.2	c.-315_-295dupTGCTGCTGCTGCTGCTGCTGC		5_prime_UTR_variant	Exon 1 of 14		NP_001341233.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ASCL1	ENST00000266744.4	c.166_186dupCAGCAGCAGCAGCAGCAGCAG	p.Gln56_Gln62dup	conservative_inframe_insertion	Exon 1 of 2	1	NM_004316.4	ENSP00000266744.3
PAH	ENST00000547319.1	n.-4_17dupTGCTGCTGCTGCTGCTGCTGC		non_coding_transcript_exon_variant	Exon 1 of 3	4
PAH	ENST00000551337.5	c.-315_-295dupTGCTGCTGCTGCTGCTGCTGC		upstream_gene_variant		3		ENSP00000447620.1
PAH	ENST00000635500.1	n.-192_-172dupTGCTGCTGCTGCTGCTGCTGC		upstream_gene_variant		3

Frequencies

GnomAD3 genomes AF: 0.000779 AC: 117 AN: 150120 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00259

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000462

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000197

Gnomad SAS AF: 0.000210

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000297

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000119 AC: 162 AN: 1356934 Hom.: 0 Cov.: 17 AF XY: 0.000118 AC XY: 79 AN XY: 669230

African (AFR) AF: 0.00225 AC: 64 AN: 28498

American (AMR) AF: 0.000297 AC: 10 AN: 33690

Ashkenazi Jewish (ASJ) AF: 0.0000833 AC: 2 AN: 24016

East Asian (EAS) AF: 0.000779 AC: 26 AN: 33382

South Asian (SAS) AF: 0.000171 AC: 13 AN: 75998

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 41214

Middle Eastern (MID) AF: 0.000735 AC: 3 AN: 4082

European-Non Finnish (NFE) AF: 0.0000302 AC: 32 AN: 1059586

Other (OTH) AF: 0.000213 AC: 12 AN: 56468

GnomAD4 genome AF: 0.000779 AC: 117 AN: 150210 Hom.: 0 Cov.: 0 AF XY: 0.000791 AC XY: 58 AN XY: 73326

African (AFR) AF: 0.00259 AC: 106 AN: 40994

American (AMR) AF: 0.000462 AC: 7 AN: 15154

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.000198 AC: 1 AN: 5054

South Asian (SAS) AF: 0.000210 AC: 1 AN: 4762

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10154

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.0000297 AC: 2 AN: 67372

Other (OTH) AF: 0.00 AC: 0 AN: 2072

Alfa AF: 0.00 Hom.: 277

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

ASCL1-related disorder Uncertain:1

Jul 03, 2024

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The ASCL1 c.166_186dup21 variant is predicted to result in an in-frame duplication (p.Gln56_Gln62dup). To our knowledge, this variant has not been reported in the literature or in a large population database, indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.22
Mutation Taster		=79/21	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3832799; hg19: chr12-103352171;