12-102958393-CGCAGCAGCAGCAGCAGCAGCAGCAGCA-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_004316.4(ASCL1):c.157_186dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG(p.Gln53_Gln62dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_004316.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- phenylketonuriaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, G2P, Labcorp Genetics (formerly Invitae), Myriad Women's Health
- classic phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- maternal phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild hyperphenylalaninemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004316.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ASCL1 | MANE Select | c.157_186dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln53_Gln62dup | conservative_inframe_insertion | Exon 1 of 2 | NP_004307.2 | P50553 | ||
| PAH | c.-324_-295dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | 5_prime_UTR | Exon 1 of 14 | NP_001341233.1 | P00439 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ASCL1 | TSL:1 MANE Select | c.157_186dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln53_Gln62dup | conservative_inframe_insertion | Exon 1 of 2 | ENSP00000266744.3 | P50553 | ||
| PAH | TSL:4 | n.-13_17dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_exon | Exon 1 of 3 | |||||
| PAH | TSL:3 | c.-324_-295dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | upstream_gene | N/A | ENSP00000447620.1 | F8W0A0 |
Frequencies
GnomAD3 genomes AF: 0.000140 AC: 21AN: 150120Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000169 AC: 23AN: 1356952Hom.: 0 Cov.: 17 AF XY: 0.0000209 AC XY: 14AN XY: 669242 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000140 AC: 21AN: 150120Hom.: 0 Cov.: 0 AF XY: 0.000164 AC XY: 12AN XY: 73222 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.