12-111598949-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGTT-G

Variant names:

• chr12-111598949-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGTT-G
• rs776315827
• NM_001372574.1:c.56_85delAACAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Benign. Variant got -7 ACMG points: 0P and 7B. BP3 BP6_Moderate BS2

The NM_001372574.1(ATXN2):​c.56_85delAACAGCAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln19_Gln28del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000117 in 1,412,048 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. Q19Q) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.00026 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00010 (0 hom.)
• Consequence: ATXN2 NM_001372574.1 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.00700

Genes affected

ATXN2 (HGNC:10555): (ataxin 2) This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]

ACMG classification

Verdict is Benign. Variant got -7 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001372574.1
• BP6: Variant 12-111598949-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGTT-G is Benign according to our data. Variant chr12-111598949-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGTT-G is described in ClinVar as [Likely_benign]. Clinvar id is 2643322.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 38 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN2	NM_001372574.1	c.56_85delAACAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln19_Gln28del	disruptive_inframe_deletion	Exon 1 of 25	ENST00000673436.1	NP_001359503.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN2	ENST00000673436.1	c.56_85delAACAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln19_Gln28del	disruptive_inframe_deletion	Exon 1 of 25		NM_001372574.1	ENSP00000500925.1

Frequencies

GnomAD3 genomes AF: 0.000262 AC: 38 AN: 145154 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000187

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000537

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00266

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000100

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000120

Gnomad OTH AF: 0.000496

GnomAD4 exome AF: 0.000100 AC: 127 AN: 1266814 Hom.: 0 AF XY: 0.000101 AC XY: 63 AN XY: 625212

Gnomad4 AFR exome AF: 0.000113

Gnomad4 AMR exome AF: 0.000682

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000442

Gnomad4 SAS exome AF: 0.000184

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000720

Gnomad4 OTH exome AF: 0.000114

GnomAD4 genome AF: 0.000262 AC: 38 AN: 145234 Hom.: 0 Cov.: 0 AF XY: 0.000268 AC XY: 19 AN XY: 70892

Gnomad4 AFR AF: 0.000187

Gnomad4 AMR AF: 0.000537

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00267

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.000100

Gnomad4 NFE AF: 0.000120

Gnomad4 OTH AF: 0.000491

Alfa AF: 0.000169 Hom.: 0

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Apr 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

ATXN2: BS1 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs776315827; hg19: chr12-112036753;