12-111598978-TTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Variant names:

• chr12-111598978-T-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC
• rs193922927
• NM_001372574.1:c.56_57insGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_001372574.1(ATXN2):​c.56_57insGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln19_Gln20insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as risk factor (★). Synonymous variant affecting the same amino acid position (i.e. Q19Q) has been classified as Benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATXN2 NM_001372574.1 disruptive_inframe_insertion
• Clinical Significance: Likely pathogenic; risk factor criteria provided, multiple submitters, no conflicts P:1 O:1
• Conservation: PhyloP100: 0.273

Genes affected

ATXN2 (HGNC:10555): (ataxin 2) This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_001372574.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN2	NM_001372574.1	c.56_57insGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln19_Gln20insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	disruptive_inframe_insertion	Exon 1 of 25	ENST00000673436.1	NP_001359503.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN2	ENST00000673436.1	c.56_57insGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln19_Gln20insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln	disruptive_inframe_insertion	Exon 1 of 25		NM_001372574.1	ENSP00000500925.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 74

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic; risk factor

Submissions summary: Pathogenic:1 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Spinocerebellar ataxia type 2 Pathogenic:1

Dec 02, 2023

3billion

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The number of CAG repeats in the ATXN2 gene is 28. ATXN2 CAG repeat expansions greater than 27 repeats are reported to be likely pathogenic. CAG repeats in the ATXN2 gene with 27-33 repeats reported as reduced-penetrance alleles (PMID: 29665996). Therefore, the variant is classified as likely pathogenic according to the recommendation of ACMG/AMP guideline. -

Amyotrophic lateral sclerosis Other:1

Jul 31, 2020

UM ALS/MND Lab, University Of Malta

Significance: risk factor

Review Status: criteria provided, single submitter

Collection Method: case-control

Elden et al. 2010 reported that intermediate-length (27-33) polyglutamine expansions in ALS are associated with increased risk for ALS, which is supportive of our classification. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922927; hg19: chr12-112036782;