13-52455635-CGCGGTGGCGGTGGCGGTGGCGGTGGCGGTG-CGCGGTG

Variant names:

• chr13-52455635-CGCGGTGGCGGTGGCGGTGGCGGTG-C
• rs72440971
• NM_018204.5:c.70+26_70+49delTGGCGGTGGCGGTGGCGGTGGCGG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_018204.5(CKAP2):​c.70+26_70+49delTGGCGGTGGCGGTGGCGGTGGCGG variant causes a intron change. The variant allele was found at a frequency of 0.0322 in 1,562,918 control chromosomes in the GnomAD database, including 1,130 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.025 (64 hom., cov: 0)
  • Exomes 𝑓: 0.033 (1066 hom.)
• Consequence: CKAP2 NM_018204.5 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.63
• Publications: 2 publications found

Genes affected

CKAP2 (HGNC:1990): (cytoskeleton associated protein 2) This gene encodes a cytoskeleton-associated protein that stabalizes microtubules and plays a role in the regulation of cell division. The encoded protein is itself regulated through phosphorylation at multiple serine and threonine residues. There is a pseudogene of this gene on chromosome 14. Alternative splicing results in multiple transcript variations. [provided by RefSeq, Nov 2013]

CKAP2-DT (HGNC:56053): (CKAP2 divergent transcript)

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.0246 (3742/151810) while in subpopulation NFE AF = 0.0357 (2423/67874). AF 95% confidence interval is 0.0345. There are 64 homozygotes in GnomAd4. There are 1741 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 64 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_018204.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CKAP2	NM_018204.5	MANE Select	c.70+26_70+49delTGGCGGTGGCGGTGGCGGTGGCGG		intron	N/A	NP_060674.3
	CKAP2	NM_001098525.3		c.70+26_70+49delTGGCGGTGGCGGTGGCGGTGGCGG		intron	N/A	NP_001091995.1	Q8WWK9-1
	CKAP2	NM_001286687.2		c.70+26_70+49delTGGCGGTGGCGGTGGCGGTGGCGG		intron	N/A	NP_001273616.1	Q8WWK9-4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CKAP2	ENST00000258607.10	TSL:1 MANE Select	c.70+10_70+33delGCGGTGGCGGTGGCGGTGGCGGTG		intron	N/A	ENSP00000258607.5	Q8WWK9-5
	CKAP2	ENST00000378037.9	TSL:1	c.70+10_70+33delGCGGTGGCGGTGGCGGTGGCGGTG		intron	N/A	ENSP00000367276.4	Q8WWK9-1
	CKAP2	ENST00000378034.7	TSL:1	c.70+10_70+33delGCGGTGGCGGTGGCGGTGGCGGTG		intron	N/A	ENSP00000367273.2	Q8WWK9-4

Frequencies

GnomAD3 genomes AF: 0.0247 AC: 3742 AN: 151702 Hom.: 64 Cov.: 0

Gnomad AFR AF: 0.00692

Gnomad AMI AF: 0.117

Gnomad AMR AF: 0.0305

Gnomad ASJ AF: 0.0482

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00208

Gnomad FIN AF: 0.0206

Gnomad MID AF: 0.00962

Gnomad NFE AF: 0.0357

Gnomad OTH AF: 0.0312

GnomAD2 exomes AF: 0.0273 AC: 5076 AN: 186206 AF XY: 0.0272

Gnomad AFR exome AF: 0.00572

Gnomad AMR exome AF: 0.0196

Gnomad ASJ exome AF: 0.0444

Gnomad EAS exome AF: 0.0000908

Gnomad FIN exome AF: 0.0221

Gnomad NFE exome AF: 0.0400

Gnomad OTH exome AF: 0.0343

GnomAD4 exome AF: 0.0330 AC: 46608 AN: 1411108 Hom.: 1066 AF XY: 0.0322 AC XY: 22596 AN XY: 701878

African (AFR) AF: 0.00688 AC: 198 AN: 28798

American (AMR) AF: 0.0206 AC: 771 AN: 37348

Ashkenazi Jewish (ASJ) AF: 0.0452 AC: 1110 AN: 24568

East Asian (EAS) AF: 0.000175 AC: 6 AN: 34292

South Asian (SAS) AF: 0.00777 AC: 633 AN: 81416

European-Finnish (FIN) AF: 0.0226 AC: 1151 AN: 50896

Middle Eastern (MID) AF: 0.0215 AC: 109 AN: 5062

European-Non Finnish (NFE) AF: 0.0374 AC: 40849 AN: 1090942

Other (OTH) AF: 0.0308 AC: 1781 AN: 57786

GnomAD4 genome AF: 0.0246 AC: 3742 AN: 151810 Hom.: 64 Cov.: 0 AF XY: 0.0235 AC XY: 1741 AN XY: 74194

African (AFR) AF: 0.00690 AC: 286 AN: 41436

American (AMR) AF: 0.0305 AC: 465 AN: 15250

Ashkenazi Jewish (ASJ) AF: 0.0482 AC: 167 AN: 3462

East Asian (EAS) AF: 0.00 AC: 0 AN: 5144

South Asian (SAS) AF: 0.00208 AC: 10 AN: 4812

European-Finnish (FIN) AF: 0.0206 AC: 217 AN: 10528

Middle Eastern (MID) AF: 0.0103 AC: 3 AN: 290

European-Non Finnish (NFE) AF: 0.0357 AC: 2423 AN: 67874

Other (OTH) AF: 0.0309 AC: 65 AN: 2106

Alfa AF: 0.0245 Hom.: 1803

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.6
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs72440971; hg19: chr13-53029770;