13-67214935-GATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001318374.2(PCDH9):c.*10369_*10406dupATATATATATATATATATATATATATATATATATATAT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001318374.2 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001318374.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PCDH9 | NM_203487.3 | MANE Select | c.3036+10432_3036+10469dupATATATATATATATATATATATATATATATATATATAT | intron | N/A | NP_982354.1 | X5D7N0 | ||
| PCDH9 | NM_001318374.2 | c.*10369_*10406dupATATATATATATATATATATATATATATATATATATAT | 3_prime_UTR | Exon 2 of 2 | NP_001305303.1 | Q5VT82 | |||
| PCDH9 | NM_020403.5 | c.3036+10432_3036+10469dupATATATATATATATATATATATATATATATATATATAT | intron | N/A | NP_065136.1 | Q9HC56-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PCDH9 | ENST00000377861.4 | TSL:1 | c.*10369_*10406dupATATATATATATATATATATATATATATATATATATAT | 3_prime_UTR | Exon 2 of 2 | ENSP00000367092.3 | Q5VT82 | ||
| PCDH9 | ENST00000377865.7 | TSL:1 MANE Select | c.3036+10432_3036+10469dupATATATATATATATATATATATATATATATATATATAT | intron | N/A | ENSP00000367096.2 | Q9HC56-1 | ||
| PCDH9 | ENST00000544246.5 | TSL:1 | c.3036+10432_3036+10469dupATATATATATATATATATATATATATATATATATATAT | intron | N/A | ENSP00000442186.2 | Q9HC56-2 |
Frequencies
GnomAD3 genomes AF: 0.0000112 AC: 1AN: 89246Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Cov.: 0
GnomAD4 genome AF: 0.0000112 AC: 1AN: 89288Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 42906 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at