14-21211228-AGTCATCCTCGCCATTGGCGCTGTCTCT-A
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PS3PM4PP5_Moderate
The NM_004500.4(HNRNPC):c.850_876delAGAGACAGCGCCAATGGCGAGGATGAC(p.Arg284_Asp292del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.00000657 in 152,104 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). ClinVar reports functional evidence for this variant: "SCV006581170: Functional studies provide moderate evidence of the variant having a damaging effect on the gene or gene product (PMID:37541189).".
Frequency
Consequence
NM_004500.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004500.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HNRNPC | MANE Select | c.850_876delAGAGACAGCGCCAATGGCGAGGATGAC | p.Arg284_Asp292del | conservative_inframe_deletion | Exon 9 of 9 | NP_004491.2 | P07910-2 | ||
| HNRNPC | c.889_915delAGAGACAGCGCCAATGGCGAGGATGAC | p.Arg297_Asp305del | conservative_inframe_deletion | Exon 8 of 8 | NP_001070910.1 | P07910-1 | |||
| HNRNPC | c.889_915delAGAGACAGCGCCAATGGCGAGGATGAC | p.Arg297_Asp305del | conservative_inframe_deletion | Exon 9 of 9 | NP_112604.2 | P07910-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HNRNPC | TSL:1 MANE Select | c.850_876delAGAGACAGCGCCAATGGCGAGGATGAC | p.Arg284_Asp292del | conservative_inframe_deletion | Exon 9 of 9 | ENSP00000450544.1 | P07910-2 | ||
| HNRNPC | TSL:1 | c.889_915delAGAGACAGCGCCAATGGCGAGGATGAC | p.Arg297_Asp305del | conservative_inframe_deletion | Exon 9 of 9 | ENSP00000451291.1 | P07910-1 | ||
| HNRNPC | TSL:1 | c.889_915delAGAGACAGCGCCAATGGCGAGGATGAC | p.Arg297_Asp305del | conservative_inframe_deletion | Exon 8 of 8 | ENSP00000452276.1 | P07910-1 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152104Hom.: 0 Cov.: 31 show subpopulations
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152104Hom.: 0 Cov.: 31 AF XY: 0.0000135 AC XY: 1AN XY: 74308 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at