14-88610947-ATTCAAATTCGTTTTTCTCATGTCAG-ATTCAAATTCGTTTTTCTCATGTCAGTTCAAATTCGTTTTTCTCATGTCAG

Variant names:

• chr14-88610947-A-ATTCAAATTCGTTTTTCTCATGTCAG
• NM_024824.5:c.2204+17_2204+41dupGTTTTTCTCATGTCAGTTCAAATTC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The ENST00000251038.10(ZC3H14):​c.2204+7_2204+8insTTCAAATTCGTTTTTCTCATGTCAG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ZC3H14 ENST00000251038.10 splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.0710

Genes affected

ZC3H14 (HGNC:20509): (zinc finger CCCH-type containing 14) The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ZC3H14	NM_024824.5	c.2204+17_2204+41dupGTTTTTCTCATGTCAGTTCAAATTC		intron_variant	Intron 16 of 16	ENST00000251038.10	NP_079100.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ZC3H14	ENST00000251038.10	c.2204+7_2204+8insTTCAAATTCGTTTTTCTCATGTCAG		splice_region_variant, intron_variant	Intron 16 of 16	1	NM_024824.5	ENSP00000251038.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr14-89077291;