14-92071010-CCTGCTGCTGCTG-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant names:

• chr14-92071010-C-CCTGCTGCTGCTGCTGCTGCTG
• rs193922928
• NM_004993.6:c.895_915dupCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Benign. The variant received -9 ACMG points: 0P and 9B. BP3 BS1 BS2

The NM_004993.6(ATXN3):​c.895_915dupCAGCAGCAGCAGCAGCAGCAG​(p.Gln299_Gln305dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0022 (10 hom., cov: 20)
  • Exomes 𝑓: 0.0027 (124 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN3 NM_004993.6 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.168
• Publications: 1 publications found

Genes affected

ATXN3 (HGNC:7106): (ataxin 3) Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]

ATXN3 Gene-Disease associations (from GenCC):

• Machado-Joseph disease

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Machado-Joseph disease type 1

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Machado-Joseph disease type 2

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Machado-Joseph disease type 3

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000303901 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -9 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_004993.6
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.00215 (307/142504) while in subpopulation SAS AF = 0.0246 (106/4310). AF 95% confidence interval is 0.0208. There are 10 homozygotes in GnomAd4. There are 184 alleles in the male GnomAd4 subpopulation. Median coverage is 20. This position passed quality control check.
• BS2: High AC in GnomAd4 at 307 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004993.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN3	NM_004993.6	MANE Select	c.895_915dupCAGCAGCAGCAGCAGCAGCAG	p.Gln299_Gln305dup	conservative_inframe_insertion	Exon 10 of 11	NP_004984.2
	ATXN3	NM_001127696.2		c.850_870dupCAGCAGCAGCAGCAGCAGCAG	p.Gln284_Gln290dup	conservative_inframe_insertion	Exon 9 of 10	NP_001121168.1	P54252-4
	ATXN3	NM_001127697.3		c.742_762dupCAGCAGCAGCAGCAGCAGCAG	p.Gln248_Gln254dup	conservative_inframe_insertion	Exon 8 of 9	NP_001121169.2	A0A0A0MS38

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN3	ENST00000644486.2	MANE Select	c.895_915dupCAGCAGCAGCAGCAGCAGCAG	p.Gln299_Gln305dup	conservative_inframe_insertion	Exon 10 of 11	ENSP00000496695.1	P54252-2
	ATXN3	ENST00000532032.5	TSL:1	c.895_915dupCAGCAGCAGCAGCAGCAGCAG	p.Gln299_Gln305dup	conservative_inframe_insertion	Exon 10 of 10	ENSP00000437157.1	P54252-1
	ATXN3	ENST00000503767.5	TSL:1	c.850_870dupCAGCAGCAGCAGCAGCAGCAG	p.Gln284_Gln290dup	conservative_inframe_insertion	Exon 9 of 10	ENSP00000426697.1	P54252-4

Frequencies

GnomAD3 genomes AF: 0.00211 AC: 300 AN: 142394 Hom.: 9 Cov.: 20

Gnomad AFR AF: 0.00213

Gnomad AMI AF: 0.0159

Gnomad AMR AF: 0.000833

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00819

Gnomad SAS AF: 0.0248

Gnomad FIN AF: 0.000405

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000647

Gnomad OTH AF: 0.00258

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00275 AC: 3604 AN: 1312582 Hom.: 124 Cov.: 92 AF XY: 0.00335 AC XY: 2202 AN XY: 656348

African (AFR) AF: 0.00847 AC: 227 AN: 26798

American (AMR) AF: 0.000692 AC: 28 AN: 40486

Ashkenazi Jewish (ASJ) AF: 0.0000820 AC: 2 AN: 24382

East Asian (EAS) AF: 0.00363 AC: 136 AN: 37442

South Asian (SAS) AF: 0.0247 AC: 1962 AN: 79426

European-Finnish (FIN) AF: 0.000552 AC: 27 AN: 48904

Middle Eastern (MID) AF: 0.00175 AC: 9 AN: 5138

European-Non Finnish (NFE) AF: 0.000970 AC: 965 AN: 994986

Other (OTH) AF: 0.00451 AC: 248 AN: 55020

GnomAD4 genome AF: 0.00215 AC: 307 AN: 142504 Hom.: 10 Cov.: 20 AF XY: 0.00266 AC XY: 184 AN XY: 69232

African (AFR) AF: 0.00226 AC: 82 AN: 36312

American (AMR) AF: 0.000833 AC: 12 AN: 14414

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3412

East Asian (EAS) AF: 0.00820 AC: 38 AN: 4634

South Asian (SAS) AF: 0.0246 AC: 106 AN: 4310

European-Finnish (FIN) AF: 0.000405 AC: 4 AN: 9884

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 282

European-Non Finnish (NFE) AF: 0.000647 AC: 43 AN: 66414

Other (OTH) AF: 0.00408 AC: 8 AN: 1962

Alfa AF: 0.00 Hom.: 345

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.17
Mutation Taster		=78/22	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922928; hg19: chr14-92537354; COSMIC: COSV61493838; COSMIC: COSV61493838;