14-92071010-CCTGCTGCTGCTG-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_004993.6(ATXN3):c.915_916insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG(p.Gln305_Gly306insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAd4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_004993.6 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Machado-Joseph diseaseInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
- Machado-Joseph disease type 1Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Machado-Joseph disease type 2Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Machado-Joseph disease type 3Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ATXN3 | NM_004993.6 | c.915_916insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln305_Gly306insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln | conservative_inframe_insertion | Exon 10 of 11 | ENST00000644486.2 | NP_004984.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| ATXN3 | ENST00000644486.2 | c.915_916insCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln305_Gly306insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln | conservative_inframe_insertion | Exon 10 of 11 | NM_004993.6 | ENSP00000496695.1 |
Frequencies
GnomAD3 genomes AF: 0.0000421 AC: 6AN: 142390Hom.: 0 Cov.: 20 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000198 AC: 26AN: 1314552Hom.: 0 Cov.: 92 AF XY: 0.0000228 AC XY: 15AN XY: 657296 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000421 AC: 6AN: 142500Hom.: 0 Cov.: 20 AF XY: 0.0000433 AC XY: 3AN XY: 69226 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at