14-93207325-T-TCGGAGCTGGAGCCCGTGGTA

Variant names:

• chr14-93207325-T-TCGGAGCTGGAGCCCGTGGTA
• NM_175748.4:c.35_54dupCGGAGCTGGAGCCCGTGGTA

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PVS1_Strong PM2 PP5

The NM_175748.4(UBR7):​c.35_54dupCGGAGCTGGAGCCCGTGGTA​(p.Ser19ArgfsTer42) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: UBR7 NM_175748.4 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 2.91

Genes affected

UBR7 (HGNC:20344): (ubiquitin protein ligase E3 component n-recognin 7) This gene encodes a UBR box-containing protein that belongs to the E3 ubiquitin ligase family. The protein also contains a plant homeodomain (PHD) in the C-terminus. In mammals, the encoded protein recognizes N-degrons, the destabilizing N-terminal residues of short-lived proteins, which results in ubiquitinylation, and proteolysis via the proteasome. [provided by RefSeq, Jul 2016]

ENSG00000259066 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.957 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 14-93207325-T-TCGGAGCTGGAGCCCGTGGTA is Pathogenic according to our data. Variant chr14-93207325-T-TCGGAGCTGGAGCCCGTGGTA is described in ClinVar as [Pathogenic]. Clinvar id is 1294425.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
UBR7	NM_175748.4	c.35_54dupCGGAGCTGGAGCCCGTGGTA	p.Ser19ArgfsTer42	frameshift_variant	Exon 1 of 11	ENST00000013070.11	NP_786924.2
UBR7	NR_038150.2	n.71_90dupCGGAGCTGGAGCCCGTGGTA		non_coding_transcript_exon_variant	Exon 1 of 10

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
UBR7	ENST00000013070.11	c.35_54dupCGGAGCTGGAGCCCGTGGTA	p.Ser19ArgfsTer42	frameshift_variant	Exon 1 of 11	1	NM_175748.4	ENSP00000013070.6
ENSG00000259066	ENST00000557574.1	c.208-2498_208-2479dupCGGAGCTGGAGCCCGTGGTA		intron_variant	Intron 2 of 4	4		ENSP00000451369.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Intellectual disability, mild Pathogenic:1

Aug 11, 2020

Shaanxi Institute for Pediatric Diseases, Xi'an Children's Hospital

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

Thec.35_54dup( p.Ser19Argfs*42) heterozygous variant in UBR7 has not been reported in previous literature, and was absent in gnomAD. we found the variant in two patients from a Chinese family. The two patients had similar clinical features, including global developmental delay, mental retardation, and facial abnormalities, epilepsy. In summary, according to ACMG guidelines, the variant was to be classified as Likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr14-93673670;