15-60497425-GACATTCTAGAAGTGCTTAGGTGATAACATTT-G
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PM2
The NM_134261.3(RORA):c.1571_*29delAAATGTTATCACCTAAGCACTTCTAGAATGT(p.Ter524fs) variant causes a frameshift, stop lost change. The variant allele was found at a frequency of 0.00000657 in 152,122 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_134261.3 frameshift, stop_lost
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
RORA | NM_134261.3 | c.1571_*29delAAATGTTATCACCTAAGCACTTCTAGAATGT | p.Ter524fs | frameshift_variant, stop_lost | Exon 11 of 11 | ENST00000335670.11 | NP_599023.1 | |
RORA | NM_134261.3 | c.1570_*29delAAATGTTATCACCTAAGCACTTCTAGAATGT | 3_prime_UTR_variant | Exon 11 of 11 | ENST00000335670.11 | NP_599023.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
RORA | ENST00000335670.11 | c.1571_*29delAAATGTTATCACCTAAGCACTTCTAGAATGT | p.Ter524fs | frameshift_variant, stop_lost | Exon 11 of 11 | 1 | NM_134261.3 | ENSP00000335087.6 | ||
RORA | ENST00000335670 | c.1570_*29delAAATGTTATCACCTAAGCACTTCTAGAATGT | 3_prime_UTR_variant | Exon 11 of 11 | 1 | NM_134261.3 | ENSP00000335087.6 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152122Hom.: 0 Cov.: 32 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000138 AC: 2AN: 1450788Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 722118 show subpopulations
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152122Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1AN XY: 74312 show subpopulations
ClinVar
Submissions by phenotype
not provided Uncertain:1
Not observed at significant frequency in large population cohorts (gnomAD); Normal stop codon changed to a Serine codon, leading to the addition of 5 amino acids at the C-terminus; Has not been previously published as pathogenic or benign to our knowledge -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at