15-71810758-AACAGCTCTGATGAGCTCCACAGTGGCTGCAGC-A

Position:

• chr15-71810758-AACAGCTCTGATGAGCTCCACAGTGGCTGCAGC-A

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_014249.4(NR2E3):​c.16_47delACAGCTCTGATGAGCTCCACAGTGGCTGCAGC​(p.Thr6fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: NR2E3 NM_014249.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.160

Genes affected

NR2E3 (HGNC:7974): (nuclear receptor subfamily 2 group E member 3) This protein is part of a large family of nuclear receptor transcription factors involved in signaling pathways. Nuclear receptors have been shown to regulate pathways involved in embryonic development, as well as in maintenance of proper cell function in adults. Members of this family are characterized by discrete domains that function in DNA and ligand binding. This gene encodes a retinal nuclear receptor that is a ligand-dependent transcription factor. Defects in this gene are a cause of enhanced S cone syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 78 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 15-71810758-AACAGCTCTGATGAGCTCCACAGTGGCTGCAGC-A is Pathogenic according to our data. Variant chr15-71810758-AACAGCTCTGATGAGCTCCACAGTGGCTGCAGC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3577620.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NR2E3	NM_014249.4	c.16_47delACAGCTCTGATGAGCTCCACAGTGGCTGCAGC	p.Thr6fs	frameshift_variant	1/8	ENST00000617575.5	NP_055064.1
NR2E3	NM_016346.4	c.16_47delACAGCTCTGATGAGCTCCACAGTGGCTGCAGC	p.Thr6fs	frameshift_variant	1/7		NP_057430.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NR2E3	ENST00000617575.5	c.16_47delACAGCTCTGATGAGCTCCACAGTGGCTGCAGC	p.Thr6fs	frameshift_variant	1/8	1	NM_014249.4	ENSP00000482504.1
NR2E3	ENST00000621098.1	c.16_47delACAGCTCTGATGAGCTCCACAGTGGCTGCAGC	p.Thr6fs	frameshift_variant	1/7	1		ENSP00000479962.1
NR2E3	ENST00000621736.4	c.-146-724_-146-693delACAGCTCTGATGAGCTCCACAGTGGCTGCAGC		intron_variant		2		ENSP00000479254.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Enhanced S-cone syndrome;C1970163:Retinitis pigmentosa 37 Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Fulgent Genetics, Fulgent Genetics

Apr 17, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr15-72103098;