15-89333596-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-T
Variant summary
Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2BP3BP6
The NM_001430120.1(POLGARF):c.184_213delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Ala62_Ala71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000033 in 151,604 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_001430120.1 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 0 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
POLG | NM_002693.3 | c.129_158delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln44_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | ENST00000268124.11 | NP_002684.1 | |
POLGARF | NM_001430120.1 | c.184_213delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Ala62_Ala71del | conservative_inframe_deletion | Exon 1 of 2 | NP_001417049.1 | ||
POLG | NM_001126131.2 | c.129_158delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln44_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | NP_001119603.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
POLGARF | ENST00000706918.1 | c.184_213delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Ala62_Ala71del | conservative_inframe_deletion | Exon 1 of 2 | ENSP00000516626.1 | ||||
POLG | ENST00000268124.11 | c.129_158delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln44_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | 1 | NM_002693.3 | ENSP00000268124.5 |
Frequencies
GnomAD3 genomes AF: 0.0000330 AC: 5AN: 151604Hom.: 0 Cov.: 30
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000159 AC: 23AN: 1446396Hom.: 0 AF XY: 0.0000181 AC XY: 13AN XY: 719198
GnomAD4 genome AF: 0.0000330 AC: 5AN: 151604Hom.: 0 Cov.: 30 AF XY: 0.0000270 AC XY: 2AN XY: 74046
ClinVar
Submissions by phenotype
Progressive sclerosing poliodystrophy Uncertain:1Benign:1
The NM_002693.2:c.129_158del (NP_002684.1:p.Gln44_Gln53del) [GRCH38: NC_000015.10:g.89333600_89333629del] variant in POLG gene is interpretated to be a Benign based on ACMG guidelines (PMID: 25741868). This variant meets the following evidence codes reported in the ACMG-guideline. BS1:The minor allele frequency of this allele is high for Mitochondrial DNA depletion syndrome 4A (Alpers type). BS2:Observation of the variant in controls is inconsistent with penetrance of Mitochondrial DNA depletion syndrome 4A (Alpers type). BP3:This variant results in inframe indel in repeats without known function. BP4:Computational evidence/predictors indicate no impact on the POLG structure, function, or protein-protein interaction. Based on the evidence criteria codes applied, the variant is suggested to be Benign. -
This variant, c.129_158del, results in the deletion of 10 amino acid(s) of the POLG protein (p.Gln46_Gln55del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLG-related conditions. ClinVar contains an entry for this variant (Variation ID: 619491). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at