15-89333596-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 2P and 2B. PM1BP3BP6
The NM_001430120.1(POLGARF):c.193_213delGCAGCAGCAGCAGCAGCAGCA(p.Ala65_Ala71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000476 in 1,598,000 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_001430120.1 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
- mitochondrial DNA depletion syndrome 4aInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Ambry Genetics
- sensory ataxic neuropathy, dysarthria, and ophthalmoparesisInheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, G2P
- autosomal dominant progressive external ophthalmoplegiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive progressive external ophthalmoplegiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mitochondrial neurogastrointestinal encephalomyopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- recessive mitochondrial ataxia syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- spinocerebellar ataxia with epilepsyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- Leigh syndromeInheritance: AR Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001430120.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLGARF | MANE Select | c.193_213delGCAGCAGCAGCAGCAGCAGCA | p.Ala65_Ala71del | conservative_inframe_deletion | Exon 1 of 2 | NP_001417049.1 | A0A3B3IS91 | ||
| POLG | MANE Select | c.138_158delGCAGCAGCAGCAGCAGCAGCA | p.Gln47_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | NP_002684.1 | P54098 | ||
| POLG | c.138_158delGCAGCAGCAGCAGCAGCAGCA | p.Gln47_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | NP_001119603.1 | P54098 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLGARF | MANE Select | c.193_213delGCAGCAGCAGCAGCAGCAGCA | p.Ala65_Ala71del | conservative_inframe_deletion | Exon 1 of 2 | ENSP00000516626.1 | A0A3B3IS91 | ||
| POLG | TSL:1 MANE Select | c.138_158delGCAGCAGCAGCAGCAGCAGCA | p.Gln47_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | ENSP00000268124.5 | P54098 | ||
| POLG | TSL:1 | c.138_158delGCAGCAGCAGCAGCAGCAGCA | p.Gln47_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | ENSP00000399851.2 | P54098 |
Frequencies
GnomAD3 genomes AF: 0.0000857 AC: 13AN: 151604Hom.: 0 Cov.: 30 show subpopulations
GnomAD4 exome AF: 0.0000436 AC: 63AN: 1446396Hom.: 0 AF XY: 0.0000473 AC XY: 34AN XY: 719198 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000857 AC: 13AN: 151604Hom.: 0 Cov.: 30 AF XY: 0.0000540 AC XY: 4AN XY: 74046 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at