15-89333596-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_002693.3(POLG):c.130_150delCAGCAGCAGCAGCAGCAGCAG(p.Gln44_Gln50del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q44Q) has been classified as Likely benign. The gene POLG is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_002693.3 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002693.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLG | MANE Select | c.130_150delCAGCAGCAGCAGCAGCAGCAG | p.Gln44_Gln50del | conservative_inframe_deletion | Exon 2 of 23 | NP_002684.1 | P54098 | ||
| POLGARF | MANE Select | c.185_205delCAGCAGCAGCAGCAGCAGCAG | p.Ala63_Ala69del | conservative_inframe_deletion | Exon 1 of 2 | NP_001417049.1 | A0A3B3IS91 | ||
| POLG | c.130_150delCAGCAGCAGCAGCAGCAGCAG | p.Gln44_Gln50del | conservative_inframe_deletion | Exon 2 of 23 | NP_001119603.1 | P54098 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLG | TSL:1 MANE Select | c.130_150delCAGCAGCAGCAGCAGCAGCAG | p.Gln44_Gln50del | conservative_inframe_deletion | Exon 2 of 23 | ENSP00000268124.5 | P54098 | ||
| POLGARF | MANE Select | c.185_205delCAGCAGCAGCAGCAGCAGCAG | p.Ala63_Ala69del | conservative_inframe_deletion | Exon 1 of 2 | ENSP00000516626.1 | A0A3B3IS91 | ||
| POLG | TSL:1 | c.130_150delCAGCAGCAGCAGCAGCAGCAG | p.Gln44_Gln50del | conservative_inframe_deletion | Exon 2 of 23 | ENSP00000399851.2 | P54098 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.