15-89333596-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGC
Variant summary
Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2BP3BP6
The NM_001430120.1(POLGARF):c.193_213delGCAGCAGCAGCAGCAGCAGCA(p.Ala65_Ala71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000476 in 1,598,000 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_001430120.1 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 0 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
POLG | NM_002693.3 | c.138_158delGCAGCAGCAGCAGCAGCAGCA | p.Gln47_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | ENST00000268124.11 | NP_002684.1 | |
POLGARF | NM_001430120.1 | c.193_213delGCAGCAGCAGCAGCAGCAGCA | p.Ala65_Ala71del | conservative_inframe_deletion | Exon 1 of 2 | NP_001417049.1 | ||
POLG | NM_001126131.2 | c.138_158delGCAGCAGCAGCAGCAGCAGCA | p.Gln47_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | NP_001119603.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
POLGARF | ENST00000706918.1 | c.193_213delGCAGCAGCAGCAGCAGCAGCA | p.Ala65_Ala71del | conservative_inframe_deletion | Exon 1 of 2 | ENSP00000516626.1 | ||||
POLG | ENST00000268124.11 | c.138_158delGCAGCAGCAGCAGCAGCAGCA | p.Gln47_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | 1 | NM_002693.3 | ENSP00000268124.5 |
Frequencies
GnomAD3 genomes AF: 0.0000857 AC: 13AN: 151604Hom.: 0 Cov.: 30
GnomAD4 exome AF: 0.0000436 AC: 63AN: 1446396Hom.: 0 AF XY: 0.0000473 AC XY: 34AN XY: 719198
GnomAD4 genome AF: 0.0000857 AC: 13AN: 151604Hom.: 0 Cov.: 30 AF XY: 0.0000540 AC XY: 4AN XY: 74046
ClinVar
Submissions by phenotype
not provided Uncertain:1
PM2 -
Progressive sclerosing poliodystrophy Uncertain:1
This variant, c.138_158del, results in the deletion of 7 amino acid(s) of the POLG protein (p.Gln49_Gln55del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLG-related conditions. ClinVar contains an entry for this variant (Variation ID: 289240). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
not specified Benign:1
- -
Inborn genetic diseases Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at