15-99712504-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001319206.4(MEF2A):​c.1256_1285dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln419_Gln428dup) variant causes a disruptive inframe insertion change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

Frequency

Genomes: 𝑓 0.000027 ( 0 hom., cov: 0)
Exomes 𝑓: 7.2e-7 ( 0 hom. )
Failed GnomAD Quality Control

Consequence

MEF2A
NM_001319206.4 disruptive_inframe_insertion

Scores

Not classified

Clinical Significance

Not reported in ClinVar

Conservation

PhyloP100: 6.55

Publications

9 publications found
Variant links:
Genes affected
MEF2A (HGNC:6993): (myocyte enhancer factor 2A) The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_benign. The variant received -1 ACMG points.

BP3
Nonframeshift variant in repetitive region in NM_001319206.4

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MEF2ANM_001319206.4 linkc.1256_1285dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC p.Gln419_Gln428dup disruptive_inframe_insertion Exon 12 of 12 ENST00000557942.6 NP_001306135.1 Q02078-2A0A0S2Z4N0

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MEF2AENST00000557942.6 linkc.1256_1285dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC p.Gln419_Gln428dup disruptive_inframe_insertion Exon 12 of 12 5 NM_001319206.4 ENSP00000453095.1 Q02078-2

Frequencies

GnomAD3 genomes
AF:
0.0000266
AC:
4
AN:
150286
Hom.:
0
Cov.:
0
show subpopulations
Gnomad AFR
AF:
0.0000980
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.00
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.00
Gnomad SAS
AF:
0.00
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.00
Gnomad OTH
AF:
0.00
GnomAD4 exome
Data not reliable, filtered out with message: AS_VQSR
AF:
7.24e-7
AC:
1
AN:
1381130
Hom.:
0
Cov.:
0
AF XY:
0.00000147
AC XY:
1
AN XY:
681108
show subpopulations
African (AFR)
AF:
0.0000319
AC:
1
AN:
31386
American (AMR)
AF:
0.00
AC:
0
AN:
35370
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
24828
East Asian (EAS)
AF:
0.00
AC:
0
AN:
35112
South Asian (SAS)
AF:
0.00
AC:
0
AN:
78090
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
47946
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
5652
European-Non Finnish (NFE)
AF:
0.00
AC:
0
AN:
1065412
Other (OTH)
AF:
0.00
AC:
0
AN:
57334
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.475
Heterozygous variant carriers
0
0
1
1
2
2
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance
GnomAD4 genome
AF:
0.0000266
AC:
4
AN:
150286
Hom.:
0
Cov.:
0
AF XY:
0.0000273
AC XY:
2
AN XY:
73250
show subpopulations
African (AFR)
AF:
0.0000980
AC:
4
AN:
40806
American (AMR)
AF:
0.00
AC:
0
AN:
15140
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
3464
East Asian (EAS)
AF:
0.00
AC:
0
AN:
5084
South Asian (SAS)
AF:
0.00
AC:
0
AN:
4710
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
10274
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
316
European-Non Finnish (NFE)
AF:
0.00
AC:
0
AN:
67544
Other (OTH)
AF:
0.00
AC:
0
AN:
2048
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.538
Heterozygous variant carriers
0
1
1
2
2
3
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Genome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
6.5
Mutation Taster
=56/44
polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs3138597; hg19: chr15-100252709; API