15-99712504-CCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAG

Position:

• chr15-99712504-CCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAG

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001319206.4(MEF2A):​c.1265_1285delAGCAGCAGCAGCAGCAGCAGC​(p.Gln422_Gln428del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00103 in 1,531,530 control chromosomes in the GnomAD database, including 11 homozygotes. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0012 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0010 (11 hom.)
• Consequence: MEF2A NM_001319206.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 6.73

Genes affected

MEF2A (HGNC:6993): (myocyte enhancer factor 2A) The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]

MEF2A (HGNC:):

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. gnomad4_exome allele frequency = 0.001 (1385/1381126) while in subpopulation EAS AF= 0.0179 (630/35110). AF 95% confidence interval is 0.0168. There are 11 homozygotes in gnomad4_exome. There are 715 alleles in male gnomad4_exome subpopulation. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 186 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MEF2A	NM_001319206.4	c.1265_1285delAGCAGCAGCAGCAGCAGCAGC	p.Gln422_Gln428del	disruptive_inframe_deletion	12/12	ENST00000557942.6	NP_001306135.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MEF2A	ENST00000557942.6	c.1265_1285delAGCAGCAGCAGCAGCAGCAGC	p.Gln422_Gln428del	disruptive_inframe_deletion	12/12	5	NM_001319206.4	ENSP00000453095.1

Frequencies

GnomAD3 genomes AF: 0.00125 AC: 188 AN: 150286 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000196

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00125

Gnomad ASJ AF: 0.00173

Gnomad EAS AF: 0.0167

Gnomad SAS AF: 0.00340

Gnomad FIN AF: 0.00302

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000266

Gnomad OTH AF: 0.00244

GnomAD4 exome AF: 0.00100 AC: 1385 AN: 1381126 Hom.: 11 AF XY: 0.00105 AC XY: 715 AN XY: 681104

Gnomad4 AFR exome AF: 0.000319

Gnomad4 AMR exome AF: 0.000565

Gnomad4 ASJ exome AF: 0.00125

Gnomad4 EAS exome AF: 0.0179

Gnomad4 SAS exome AF: 0.00265

Gnomad4 FIN exome AF: 0.00288

Gnomad4 NFE exome AF: 0.000270

Gnomad4 OTH exome AF: 0.000977

GnomAD4 genome AF: 0.00124 AC: 186 AN: 150404 Hom.: 0 Cov.: 0 AF XY: 0.00147 AC XY: 108 AN XY: 73376

Gnomad4 AFR AF: 0.000195

Gnomad4 AMR AF: 0.00125

Gnomad4 ASJ AF: 0.00173

Gnomad4 EAS AF: 0.0166

Gnomad4 SAS AF: 0.00340

Gnomad4 FIN AF: 0.00302

Gnomad4 NFE AF: 0.000267

Gnomad4 OTH AF: 0.00193

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3138597; hg19: chr15-100252709;