16-1209078-C-CCTGGAGCAGCCGGCGCTCCAG

Variant names:

• chr16-1209078-C-CCTGGAGCAGCCGGCGCTCCAG
• rs746597383
• NM_021098.3:c.3422_3442dupGGCGCTCCAGCTGGAGCAGCC

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4 BS1_Supporting BS2

The NM_021098.3(CACNA1H):​c.3422_3442dupGGCGCTCCAGCTGGAGCAGCC​(p.Arg1141_Ser1147dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000125 in 1,545,256 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.000053 (0 hom., cov: 33)
  • Exomes 𝑓: 0.00013 (0 hom.)
• Consequence: CACNA1H NM_021098.3 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 0.722
• Publications: 0 publications found

Genes affected

CACNA1H (HGNC:1395): (calcium voltage-gated channel subunit alpha1 H) This gene encodes a T-type member of the alpha-1 subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. The alpha-1 subunit has 24 transmembrane segments and forms the pore through which ions pass into the cell. There are multiple isoforms of each of the proteins in the complex, either encoded by different genes or the result of alternative splicing of transcripts. Alternate transcriptional splice variants, encoding different isoforms, have been characterized for the gene described here. Studies suggest certain mutations in this gene lead to childhood absence epilepsy (CAE). [provided by RefSeq, Jul 2008]

CACNA1H Gene-Disease associations (from GenCC):

• hyperaldosteronism, familial, type IV

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• childhood absence epilepsy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• epilepsy, childhood absence, susceptibility to, 6

  Inheritance: AD Classification: LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_021098.3.
• BS1: Variant frequency is greater than expected in population eas. GnomAdExome4 allele frequency = 0.000133 (185/1392954) while in subpopulation EAS AF = 0.000821 (30/36540). AF 95% confidence interval is 0.00059. There are 0 homozygotes in GnomAdExome4. There are 92 alleles in the male GnomAdExome4 subpopulation. Median coverage is 31. This position passed quality control check. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting
• BS2: High AC in GnomAd4 at 8 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_021098.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CACNA1H	NM_021098.3	MANE Select	c.3422_3442dupGGCGCTCCAGCTGGAGCAGCC	p.Arg1141_Ser1147dup	disruptive_inframe_insertion	Exon 17 of 35	NP_066921.2
	CACNA1H	NM_001005407.2		c.3422_3442dupGGCGCTCCAGCTGGAGCAGCC	p.Arg1141_Ser1147dup	disruptive_inframe_insertion	Exon 17 of 34	NP_001005407.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CACNA1H	ENST00000348261.11	TSL:1 MANE Select	c.3422_3442dupGGCGCTCCAGCTGGAGCAGCC	p.Arg1141_Ser1147dup	disruptive_inframe_insertion	Exon 17 of 35	ENSP00000334198.7
	CACNA1H	ENST00000569107.6	TSL:1	c.3422_3442dupGGCGCTCCAGCTGGAGCAGCC	p.Arg1141_Ser1147dup	disruptive_inframe_insertion	Exon 17 of 34	ENSP00000454990.2
	CACNA1H	ENST00000711493.1		c.3422_3442dupGGCGCTCCAGCTGGAGCAGCC	p.Arg1141_Ser1147dup	disruptive_inframe_insertion	Exon 17 of 34	ENSP00000518778.1

Frequencies

GnomAD3 genomes AF: 0.0000526 AC: 8 AN: 152184 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000193

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0000941

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000735

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00 AC: 0 AN: 147410 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000133 AC: 185 AN: 1392954 Hom.: 0 Cov.: 31 AF XY: 0.000134 AC XY: 92 AN XY: 687620

African (AFR) AF: 0.00 AC: 0 AN: 31066

American (AMR) AF: 0.0000596 AC: 2 AN: 33532

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24292

East Asian (EAS) AF: 0.000821 AC: 30 AN: 36540

South Asian (SAS) AF: 0.0000903 AC: 7 AN: 77550

European-Finnish (FIN) AF: 0.0000221 AC: 1 AN: 45160

Middle Eastern (MID) AF: 0.000183 AC: 1 AN: 5476

European-Non Finnish (NFE) AF: 0.000130 AC: 141 AN: 1081670

Other (OTH) AF: 0.0000520 AC: 3 AN: 57668

GnomAD4 genome AF: 0.0000525 AC: 8 AN: 152302 Hom.: 0 Cov.: 33 AF XY: 0.0000537 AC XY: 4 AN XY: 74460

African (AFR) AF: 0.0000241 AC: 1 AN: 41570

American (AMR) AF: 0.00 AC: 0 AN: 15304

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.000193 AC: 1 AN: 5170

South Asian (SAS) AF: 0.00 AC: 0 AN: 4832

European-Finnish (FIN) AF: 0.0000941 AC: 1 AN: 10624

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000735 AC: 5 AN: 68014

Other (OTH) AF: 0.00 AC: 0 AN: 2112

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Epilepsy, childhood absence, susceptibility to, 6;C4310756:Hyperaldosteronism, familial, type IV (1)
-	1	-	Idiopathic generalized epilepsy;C4310756:Hyperaldosteronism, familial, type IV (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.72
Mutation Taster		=85/15	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs746597383; hg19: chr16-1259078;