16-2048047-CGCGGTGGCGCGGCGCGGGGT-C

Variant names:

• chr16-2048047-CGCGGTGGCGCGGCGCGGGGT-C
• NM_000548.5:c.-47_-30+2delGCGGTGGCGCGGCGCGGGGT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_000548.5(TSC2):​c.-47_-30+2delGCGGTGGCGCGGCGCGGGGT variant causes a splice donor, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TSC2 NM_000548.5 splice_donor, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.499

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

NTHL1 (HGNC:8028): (nth like DNA glycosylase 1) The protein encoded by this gene is a DNA N-glycosylase of the endonuclease III family. Like a similar protein in E. coli, the encoded protein has DNA glycosylase activity on DNA substrates containing oxidized pyrimidine residues and has apurinic/apyrimidinic lyase activity. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.014933628 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.-47_-30+2delGCGGTGGCGCGGCGCGGGGT		splice_region_variant	Exon 1 of 42	ENST00000219476.9	NP_000539.2
TSC2	NM_000548.5	c.-47_-30+2delGCGGTGGCGCGGCGCGGGGT		splice_donor_variant, 5_prime_UTR_variant, intron_variant	Exon 1 of 42	ENST00000219476.9	NP_000539.2
TSC2	NM_000548.5	c.-47_-30+2delGCGGTGGCGCGGCGCGGGGT		non_coding_transcript_variant		ENST00000219476.9	NP_000539.2
NTHL1	NM_002528.7	c.-244_-225delACCCCGCGCCGCGCCACCGC		upstream_gene_variant		ENST00000651570.2	NP_002519.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.-47_-30+2delGCGGTGGCGCGGCGCGGGGT		splice_region_variant	Exon 1 of 42	5	NM_000548.5	ENSP00000219476.3
TSC2	ENST00000219476	c.-47_-30+2delGCGGTGGCGCGGCGCGGGGT		splice_donor_variant, 5_prime_UTR_variant, intron_variant	Exon 1 of 42	5	NM_000548.5	ENSP00000219476.3
TSC2	ENST00000219476.9	c.-47_-30+2delGCGGTGGCGCGGCGCGGGGT		non_coding_transcript_variant		5	NM_000548.5	ENSP00000219476.3
NTHL1	ENST00000651570.2	c.-244_-225delACCCCGCGCCGCGCCACCGC		upstream_gene_variant			NM_002528.7	ENSP00000498421.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Tuberous sclerosis 2 Uncertain:1

Apr 17, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant occurs in a non-coding region of the TSC2 gene. It does not change the encoded amino acid sequence of the TSC2 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TSC2-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr16-2098048;