16-29812954-C-CCCTCCTCACCCCAAGCCTATCT
Variant summary
Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2BP6_Moderate
The NM_145239.3(PRRT2):c.-65-28_-65-7dupACCCCAAGCCTATCTCCTCCTC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,126 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_145239.3 splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 0 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PRRT2 | ENST00000358758.12 | c.-65-36_-65-35insCCTCCTCACCCCAAGCCTATCT | intron_variant | Intron 1 of 3 | 1 | NM_145239.3 | ENSP00000351608.7 | |||
ENSG00000280893 | ENST00000609618.2 | n.-65-36_-65-35insCCTCCTCACCCCAAGCCTATCT | intron_variant | Intron 1 of 5 | 5 | ENSP00000476774.2 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152126Hom.: 0 Cov.: 31
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000170 AC: 2AN: 1177682Hom.: 0 Cov.: 17 AF XY: 0.00 AC XY: 0AN XY: 585102
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152126Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0AN XY: 74316
ClinVar
Submissions by phenotype
not specified Benign:1
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at