16-29813029-GGCTCTCTCCCCTCTCCCATCTCAAGATGGCAGCCAGCA-G

Position:

• chr16-29813029-GGCTCTCTCCCCTCTCCCATCTCAAGATGGCAGCCAGCA-G

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_145239.3(PRRT2):​c.-20_18delCTCCCCTCTCCCATCTCAAGATGGCAGCCAGCAGCTCT​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000706 in 1,417,422 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 7.1e-7 (0 hom.)
• Consequence: PRRT2 NM_145239.3 frameshift, start_lost
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.12

Genes affected

PRRT2 (HGNC:30500): (proline rich transmembrane protein 2) This gene encodes a transmembrane protein containing a proline-rich domain in its N-terminal half. Studies in mice suggest that it is predominantly expressed in brain and spinal cord in embryonic and postnatal stages. Mutations in this gene are associated with episodic kinesigenic dyskinesia-1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

ENSG00000280893 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 16 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PRRT2	NM_145239.3	c.-20_18delCTCCCCTCTCCCATCTCAAGATGGCAGCCAGCAGCTCT	p.Met1fs	frameshift_variant, start_lost	2/4	ENST00000358758.12	NP_660282.2
PRRT2	NM_145239.3	c.-20_18delCTCCCCTCTCCCATCTCAAGATGGCAGCCAGCAGCTCT		5_prime_UTR_variant	2/4	ENST00000358758.12	NP_660282.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PRRT2	ENST00000358758.12	c.-20_18delCTCCCCTCTCCCATCTCAAGATGGCAGCCAGCAGCTCT	p.Met1fs	frameshift_variant, start_lost	2/4	1	NM_145239.3	ENSP00000351608.7
PRRT2	ENST00000358758	c.-20_18delCTCCCCTCTCCCATCTCAAGATGGCAGCCAGCAGCTCT		5_prime_UTR_variant	2/4	1	NM_145239.3	ENSP00000351608.7
ENSG00000280893	ENST00000609618.2	n.-20_18delCTCCCCTCTCCCATCTCAAGATGGCAGCCAGCAGCTCT		non_coding_transcript_exon_variant	2/6	5		ENSP00000476774.2
ENSG00000280893	ENST00000609618.2	n.-20_18delCTCCCCTCTCCCATCTCAAGATGGCAGCCAGCAGCTCT		5_prime_UTR_variant	2/6	5		ENSP00000476774.2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 7.06e-7 AC: 1 AN: 1417422 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 701874

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000127

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Episodic kinesigenic dyskinesia Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Aug 09, 2022

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with PRRT2-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the PRRT2 mRNA. The next in-frame methionine is located at codon 11. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr16-29824350;