16-48167586-TTCACGGATTGTGCGCTGGATCAGGGTG-TTCACGGATTGTGCGCTGGATCAGGGTGTCACGGATTGTGCGCTGGATCAGGGTG

Position:

• chr16-48167586-TTCACGGATTGTGCGCTGGATCAGGGTG-TTCACGGATTGTGCGCTGGATCAGGGTGTCACGGATTGTGCGCTGGATCAGGGTG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_001370497.1(ABCC11):​c.3939_3965dupCACCCTGATCCAGCGCACAATCCGTGA​(p.Asp1313_Arg1321dup) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ABCC11 NM_001370497.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.11

Genes affected

ABCC11 (HGNC:14639): (ATP binding cassette subfamily C member 11) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]

ABCC11 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001370497.1.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ABCC11	NM_001370497.1	c.3939_3965dupCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321dup	disruptive_inframe_insertion	29/30	ENST00000356608.7	NP_001357426.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ABCC11	ENST00000356608.7	c.3939_3965dupCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321dup	disruptive_inframe_insertion	29/30	1	NM_001370497.1	ENSP00000349017.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs387906296; hg19: chr16-48201497;