16-48167586-TTCACGGATTGTGCGCTGGATCAGGGTG-TTCACGGATTGTGCGCTGGATCAGGGTGTCACGGATTGTGCGCTGGATCAGGGTG

Variant names:

• chr16-48167586-T-TTCACGGATTGTGCGCTGGATCAGGGTG
• rs387906296
• NM_001370497.1:c.3939_3965dupCACCCTGATCCAGCGCACAATCCGTGA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The ENST00000356608.7(ABCC11):​c.3939_3965dupCACCCTGATCCAGCGCACAATCCGTGA​(p.Asp1313_Arg1321dup) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ABCC11 ENST00000356608.7 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.11
• Publications: 1 publications found

Genes affected

ABCC11 (HGNC:14639): (ATP binding cassette subfamily C member 11) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in ENST00000356608.7.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000356608.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ABCC11	NM_001370497.1	MANE Select	c.3939_3965dupCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321dup	disruptive_inframe_insertion	Exon 29 of 30	NP_001357426.1
	ABCC11	NM_001370496.1		c.3945_3971dupCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1315_Arg1323dup	disruptive_inframe_insertion	Exon 29 of 30	NP_001357425.1
	ABCC11	NM_032583.4		c.3939_3965dupCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321dup	disruptive_inframe_insertion	Exon 30 of 31	NP_115972.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ABCC11	ENST00000356608.7	TSL:1 MANE Select	c.3939_3965dupCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321dup	disruptive_inframe_insertion	Exon 29 of 30	ENSP00000349017.2
	ABCC11	ENST00000394747.5	TSL:1	c.3939_3965dupCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321dup	disruptive_inframe_insertion	Exon 28 of 29	ENSP00000378230.1
	ABCC11	ENST00000394748.5	TSL:1	c.3939_3965dupCACCCTGATCCAGCGCACAATCCGTGA	p.Asp1313_Arg1321dup	disruptive_inframe_insertion	Exon 29 of 30	ENSP00000378231.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs387906296; hg19: chr16-48201497;