16-67195890-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr16-67195890-A-ACAGCAGCAGCAGCAGCAGCAGCAG
• rs3830472
• NM_001950.4:c.935_958dupGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001950.4(E2F4):​c.935_958dupGCAGCAGCAGCAGCAGCAGCAGCA​(p.Ser312_Ser319dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000131 in 1,607,984 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000073 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0000069 (0 hom.)
• Consequence: E2F4 NM_001950.4 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.01
• Publications: 11 publications found

Genes affected

E2F4 (HGNC:3118): (E2F transcription factor 4) The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001950.4
• BS2: High AC in GnomAd4 at 11 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001950.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	E2F4	NM_001950.4	MANE Select	c.935_958dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Ser312_Ser319dup	disruptive_inframe_insertion	Exon 7 of 10	NP_001941.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	E2F4	ENST00000379378.8	TSL:1 MANE Select	c.935_958dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Ser312_Ser319dup	disruptive_inframe_insertion	Exon 7 of 10	ENSP00000368686.3	Q16254
	E2F4	ENST00000914909.1		c.935_958dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Ser312_Ser319dup	disruptive_inframe_insertion	Exon 7 of 10	ENSP00000584968.1
	E2F4	ENST00000957228.1		c.950_973dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Ser317_Ser324dup	disruptive_inframe_insertion	Exon 7 of 10	ENSP00000627287.1

Frequencies

GnomAD3 genomes AF: 0.0000732 AC: 11 AN: 150350 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.000196

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000662

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000209

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000686 AC: 10 AN: 1457634 Hom.: 0 Cov.: 30 AF XY: 0.0000110 AC XY: 8 AN XY: 725044

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000304 AC: 1 AN: 32892

American (AMR) AF: 0.00 AC: 0 AN: 44574

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26076

East Asian (EAS) AF: 0.0000253 AC: 1 AN: 39534

South Asian (SAS) AF: 0.0000350 AC: 3 AN: 85730

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53052

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5730

European-Non Finnish (NFE) AF: 0.00000360 AC: 4 AN: 1109940

Other (OTH) AF: 0.0000166 AC: 1 AN: 60106

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000000000149469), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000732 AC: 11 AN: 150350 Hom.: 0 Cov.: 31 AF XY: 0.0000682 AC XY: 5 AN XY: 73330

African (AFR) AF: 0.000196 AC: 8 AN: 40720

American (AMR) AF: 0.0000662 AC: 1 AN: 15100

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3464

East Asian (EAS) AF: 0.00 AC: 0 AN: 5146

South Asian (SAS) AF: 0.000209 AC: 1 AN: 4784

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10260

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000148 AC: 1 AN: 67580

Other (OTH) AF: 0.00 AC: 0 AN: 2070

Alfa AF: 0.00 Hom.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=75/25	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3830472; hg19: chr16-67229793;