16-67195890-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr16-67195890-A-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs3830472
• NM_001950.4:c.929_958dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001950.4(E2F4):​c.929_958dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Ser310_Ser319dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000133 in 150,350 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0000041 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: E2F4 NM_001950.4 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.01

Genes affected

E2F4 (HGNC:3118): (E2F transcription factor 4) The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
E2F4	NM_001950.4	c.929_958dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Ser310_Ser319dup	disruptive_inframe_insertion	Exon 7 of 10	ENST00000379378.8	NP_001941.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
E2F4	ENST00000379378.8	c.929_958dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Ser310_Ser319dup	disruptive_inframe_insertion	Exon 7 of 10	1	NM_001950.4	ENSP00000368686.3

Frequencies

GnomAD3 genomes AF: 0.0000133 AC: 2 AN: 150350 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000296

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000412 AC: 6 AN: 1457634 Hom.: 0 Cov.: 30 AF XY: 0.00000414 AC XY: 3 AN XY: 725044

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000224

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000253

Gnomad4 SAS exome AF: 0.0000117

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000180

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000133 AC: 2 AN: 150350 Hom.: 0 Cov.: 31 AF XY: 0.0000273 AC XY: 2 AN XY: 73330

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000296

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3830472; hg19: chr16-67229793;