16-67842866-GCAGCAGCAACAGCAGCAGCAGCAGCAA-G

Variant names:

• chr16-67842866-GCAGCAGCAACAGCAGCAGCAGCAGCAA-G
• rs745578392
• NM_020457.3:c.348_374delACAGCAGCAGCAGCAGCAACAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_020457.3(THAP11):​c.348_374delACAGCAGCAGCAGCAGCAACAGCAGCA​(p.Gln117_Gln125del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000782 in 150,978 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.00078 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00075 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: THAP11 NM_020457.3 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 4.87

Genes affected

THAP11 (HGNC:23194): (THAP domain containing 11) The protein encoded by this gene contains a THAP domain, which is a conserved DNA-binding domain that has striking similarity to the site-specific DNA-binding domain (DBD) of Drosophila P element transposases. [provided by RefSeq, Jul 2008]

CENPT (HGNC:25787): (centromere protein T) The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_020457.3
• BS2: High AC in GnomAd4 at 118 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
THAP11	NM_020457.3	c.348_374delACAGCAGCAGCAGCAGCAACAGCAGCA	p.Gln117_Gln125del	disruptive_inframe_deletion	Exon 1 of 1	ENST00000303596.3	NP_065190.2
CENPT	NM_025082.4	c.-492+4508_-492+4534delTTGCTGCTGCTGCTGCTGTTGCTGCTG		intron_variant	Intron 1 of 15	ENST00000562787.6	NP_079358.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
THAP11	ENST00000303596.3	c.348_374delACAGCAGCAGCAGCAGCAACAGCAGCA	p.Gln117_Gln125del	disruptive_inframe_deletion	Exon 1 of 1	6	NM_020457.3	ENSP00000304689.1
CENPT	ENST00000562787.6	c.-492+4508_-492+4534delTTGCTGCTGCTGCTGCTGTTGCTGCTG		intron_variant	Intron 1 of 15	2	NM_025082.4	ENSP00000457810.1

Frequencies

GnomAD3 genomes AF: 0.000789 AC: 119 AN: 150872 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000268

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000791

Gnomad ASJ AF: 0.00461

Gnomad EAS AF: 0.000584

Gnomad SAS AF: 0.00399

Gnomad FIN AF: 0.000378

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000785

Gnomad OTH AF: 0.000483

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000752 AC: 1094 AN: 1455544 Hom.: 0 AF XY: 0.000880 AC XY: 637 AN XY: 724230

Gnomad4 AFR exome AF: 0.000330

Gnomad4 AMR exome AF: 0.000359

Gnomad4 ASJ exome AF: 0.00430

Gnomad4 EAS exome AF: 0.000353

Gnomad4 SAS exome AF: 0.00446

Gnomad4 FIN exome AF: 0.000290

Gnomad4 NFE exome AF: 0.000432

Gnomad4 OTH exome AF: 0.00102

GnomAD4 genome AF: 0.000782 AC: 118 AN: 150978 Hom.: 0 Cov.: 32 AF XY: 0.000881 AC XY: 65 AN XY: 73798

Gnomad4 AFR AF: 0.000268

Gnomad4 AMR AF: 0.000724

Gnomad4 ASJ AF: 0.00461

Gnomad4 EAS AF: 0.000585

Gnomad4 SAS AF: 0.00399

Gnomad4 FIN AF: 0.000378

Gnomad4 NFE AF: 0.000785

Gnomad4 OTH AF: 0.000478

Alfa AF: 0.000551 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:2

Oct 29, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.348_374del, results in the deletion of 9 amino acid(s) of the THAP11 protein (p.Gln124_Gln132del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with THAP11-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

-

Breakthrough Genomics, Breakthrough Genomics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: not provided

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs745578392; hg19: chr16-67876769;