16-67842866-GCAGCAGCAACAGCAGCAGCAGCAGCAA-G
Variant summary
Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3BS2
The NM_020457.3(THAP11):c.348_374delACAGCAGCAGCAGCAGCAACAGCAGCA(p.Gln117_Gln125del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000782 in 150,978 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. Q116Q) has been classified as Likely benign.
Frequency
Consequence
NM_020457.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -5 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
THAP11 | NM_020457.3 | c.348_374delACAGCAGCAGCAGCAGCAACAGCAGCA | p.Gln117_Gln125del | disruptive_inframe_deletion | Exon 1 of 1 | ENST00000303596.3 | NP_065190.2 | |
CENPT | NM_025082.4 | c.-492+4508_-492+4534delTTGCTGCTGCTGCTGCTGTTGCTGCTG | intron_variant | Intron 1 of 15 | ENST00000562787.6 | NP_079358.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
THAP11 | ENST00000303596.3 | c.348_374delACAGCAGCAGCAGCAGCAACAGCAGCA | p.Gln117_Gln125del | disruptive_inframe_deletion | Exon 1 of 1 | 6 | NM_020457.3 | ENSP00000304689.1 | ||
CENPT | ENST00000562787.6 | c.-492+4508_-492+4534delTTGCTGCTGCTGCTGCTGTTGCTGCTG | intron_variant | Intron 1 of 15 | 2 | NM_025082.4 | ENSP00000457810.1 |
Frequencies
GnomAD3 genomes AF: 0.000789 AC: 119AN: 150872Hom.: 0 Cov.: 32
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000752 AC: 1094AN: 1455544Hom.: 0 AF XY: 0.000880 AC XY: 637AN XY: 724230
GnomAD4 genome AF: 0.000782 AC: 118AN: 150978Hom.: 0 Cov.: 32 AF XY: 0.000881 AC XY: 65AN XY: 73798
ClinVar
Submissions by phenotype
not provided Uncertain:2
This variant, c.348_374del, results in the deletion of 9 amino acid(s) of the THAP11 protein (p.Gln124_Gln132del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with THAP11-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at