16-87604287-C-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3BS2
The NM_001271604.4(JPH3):c.443_472dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG(p.Ala148_Ala157dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001271604.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Huntington disease-like 2Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001271604.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| JPH3 | NM_020655.4 | MANE Select | c.382+772_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A | NP_065706.2 | |||
| JPH3 | NM_001271604.4 | c.443_472dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | p.Ala148_Ala157dup | disruptive_inframe_insertion | Exon 2 of 2 | NP_001258533.1 | F8W9A3 | ||
| JPH3 | NM_001271605.3 | c.*141_*170dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | 3_prime_UTR | Exon 2 of 2 | NP_001258534.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| JPH3 | ENST00000284262.3 | TSL:1 MANE Select | c.382+772_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A | ENSP00000284262.2 | Q8WXH2-1 | ||
| JPH3 | ENST00000301008.5 | TSL:1 | n.703_732dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | non_coding_transcript_exon | Exon 2 of 2 | ||||
| JPH3 | ENST00000537256.5 | TSL:2 | n.96+2370_96+2399dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.000580 AC: 87AN: 149958Hom.: 1 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000179 AC: 229AN: 1282836Hom.: 7 Cov.: 30 AF XY: 0.000166 AC XY: 105AN XY: 633000 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000586 AC: 88AN: 150066Hom.: 1 Cov.: 0 AF XY: 0.000601 AC XY: 44AN XY: 73222 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at