16-87604287-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-CCTG

Variant names:

• chr16-87604287-CCTGCTGCTGCTGCTGCTGCTGCTGCTG-C
• rs71156237
• ENST00000301008.5:n.706_732delCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2

The ENST00000301008.5(JPH3):​n.706_732delCTGCTGCTGCTGCTGCTGCTGCTGCTG variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000108 in 1,432,906 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00049 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000064 (0 hom.)
• Consequence: JPH3 ENST00000301008.5 non_coding_transcript_exon
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.966
• Publications: 1 publications found

Genes affected

JPH3 (HGNC:14203): (junctophilin 3) Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansion from normally 6-28 repeats to 40-59 repeats in the 3' UTR of this gene have been associated with Huntington disease-like 2 (HDL2). This gene is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2016]

JPH3 Gene-Disease associations (from GenCC):

• Huntington disease-like 2

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• BS2: High AC in GnomAd4 at 73 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
JPH3	NM_020655.4	c.382+775_382+801delCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 4	ENST00000284262.3	NP_065706.2
JPH3	NM_001271604.4	c.446_472delCTGCTGCTGCTGCTGCTGCTGCTGCTG	p.Ala149_Ala157del	disruptive_inframe_deletion	Exon 2 of 2		NP_001258533.1
JPH3	NM_001271605.3	c.*144_*170delCTGCTGCTGCTGCTGCTGCTGCTGCTG		3_prime_UTR_variant	Exon 2 of 2		NP_001258534.1
JPH3	NR_073379.3	n.96+2373_96+2399delCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
JPH3	ENST00000301008.5	n.706_732delCTGCTGCTGCTGCTGCTGCTGCTGCTG		non_coding_transcript_exon_variant	Exon 2 of 2	1
JPH3	ENST00000284262.3	c.382+775_382+801delCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 4	1	NM_020655.4	ENSP00000284262.2
JPH3	ENST00000537256.5	n.96+2373_96+2399delCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron_variant	Intron 1 of 5	2

Frequencies

GnomAD3 genomes AF: 0.000487 AC: 73 AN: 149958 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00168

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000661

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000445

Gnomad OTH AF: 0.000487

GnomAD4 exome AF: 0.0000639 AC: 82 AN: 1282840 Hom.: 0 AF XY: 0.0000648 AC XY: 41 AN XY: 633000

African (AFR) AF: 0.00102 AC: 29 AN: 28326

American (AMR) AF: 0.0000309 AC: 1 AN: 32396

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 21658

East Asian (EAS) AF: 0.0000415 AC: 1 AN: 24078

South Asian (SAS) AF: 0.00 AC: 0 AN: 77828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 29388

Middle Eastern (MID) AF: 0.000198 AC: 1 AN: 5062

European-Non Finnish (NFE) AF: 0.0000474 AC: 48 AN: 1013032

Other (OTH) AF: 0.0000392 AC: 2 AN: 51072

GnomAD4 genome AF: 0.000486 AC: 73 AN: 150066 Hom.: 0 Cov.: 0 AF XY: 0.000533 AC XY: 39 AN XY: 73222

African (AFR) AF: 0.00167 AC: 68 AN: 40668

American (AMR) AF: 0.0000660 AC: 1 AN: 15150

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3448

East Asian (EAS) AF: 0.00 AC: 0 AN: 5062

South Asian (SAS) AF: 0.00 AC: 0 AN: 4710

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10302

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.0000445 AC: 3 AN: 67458

Other (OTH) AF: 0.000482 AC: 1 AN: 2076

Alfa AF: 0.00 Hom.: 316

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.97
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71156237; hg19: chr16-87637893;