16-87604287-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG-CCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3BS2
The NM_001271604.4(JPH3):c.449_472delCTGCTGCTGCTGCTGCTGCTGCTG(p.Ala150_Ala157del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000188 in 1,432,906 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001271604.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Huntington disease-like 2Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001271604.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| JPH3 | MANE Select | c.382+778_382+801delCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A | NP_065706.2 | ||||
| JPH3 | c.449_472delCTGCTGCTGCTGCTGCTGCTGCTG | p.Ala150_Ala157del | disruptive_inframe_deletion | Exon 2 of 2 | NP_001258533.1 | F8W9A3 | |||
| JPH3 | c.*147_*170delCTGCTGCTGCTGCTGCTGCTGCTG | 3_prime_UTR | Exon 2 of 2 | NP_001258534.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| JPH3 | TSL:1 MANE Select | c.382+778_382+801delCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A | ENSP00000284262.2 | Q8WXH2-1 | |||
| JPH3 | TSL:1 | n.709_732delCTGCTGCTGCTGCTGCTGCTGCTG | non_coding_transcript_exon | Exon 2 of 2 | |||||
| JPH3 | TSL:2 | n.96+2376_96+2399delCTGCTGCTGCTGCTGCTGCTGCTG | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.0000400 AC: 6AN: 149958Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.0000164 AC: 21AN: 1282840Hom.: 0 AF XY: 0.0000190 AC XY: 12AN XY: 633000 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000400 AC: 6AN: 150066Hom.: 0 Cov.: 0 AF XY: 0.0000273 AC XY: 2AN XY: 73222 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at