17-11598500-TGCGGCTCGCGGAGGAGCGGGCCGCGCTC-T

Position:

• chr17-11598500-TGCGGCTCGCGGAGGAGCGGGCCGCGCTC-T

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_001372.4(DNAH9):​c.8_35delTCGCGGAGGAGCGGGCCGCGCTCGCGGC​(p.Leu3fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: DNAH9 NM_001372.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.07

Genes affected

DNAH9 (HGNC:2953): (dynein axonemal heavy chain 9) This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

DNAH9 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 8 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-11598500-TGCGGCTCGCGGAGGAGCGGGCCGCGCTC-T is Pathogenic according to our data. Variant chr17-11598500-TGCGGCTCGCGGAGGAGCGGGCCGCGCTC-T is described in ClinVar as [Pathogenic]. Clinvar id is 2957745.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
DNAH9	NM_001372.4	c.8_35delTCGCGGAGGAGCGGGCCGCGCTCGCGGC	p.Leu3fs	frameshift_variant	1/69	ENST00000262442.9	NP_001363.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
DNAH9	ENST00000262442.9	c.8_35delTCGCGGAGGAGCGGGCCGCGCTCGCGGC	p.Leu3fs	frameshift_variant	1/69	1	NM_001372.4	ENSP00000262442.3
DNAH9	ENST00000579406.1	n.35_62delTCGCGGAGGAGCGGGCCGCGCTCGCGGC		non_coding_transcript_exon_variant	1/8	1
DNAH9	ENST00000454412.6	c.8_35delTCGCGGAGGAGCGGGCCGCGCTCGCGGC	p.Leu3fs	frameshift_variant	1/68	5		ENSP00000414874.2
DNAH9	ENST00000579828.5	c.8_35delTCGCGGAGGAGCGGGCCGCGCTCGCGGC	p.Leu3fs	frameshift_variant	1/4	2		ENSP00000463782.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jun 17, 2023

This variant has not been reported in the literature in individuals affected with DNAH9-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu3Argfs*23) in the DNAH9 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in DNAH9 are known to be pathogenic (PMID: 30471718). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-11501817;