17-17793779-CCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAG

Variant names:

• chr17-17793779-CCAGCAGCAGCAGCAGCAGCAGCAG-C
• rs371983878
• NM_030665.4:c.849_872delGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BS1 BS2

The NM_030665.4(RAI1):​c.849_872delGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln284_Gln291del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000317 in 1,357,644 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. Q283Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000025 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000032 (0 hom.)
• Consequence: RAI1 NM_030665.4 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts U:1 B:3
• Conservation: PhyloP100: 4.86
• Publications: 8 publications found

Genes affected

RAI1 (HGNC:9834): (retinoic acid induced 1) This gene is located within the Smith-Magenis syndrome region on chromosome 17. It is highly similar to its mouse counterpart and is expressed at high levels mainly in neuronal tissues. The protein encoded by this gene includes a polymorphic polyglutamine tract in the N-terminal domain. Expression of the mouse counterpart in neurons is induced by retinoic acid. This gene is associated with both the severity of the phenotype and the response to medication in schizophrenic patients. [provided by RefSeq, Jul 2008]

RAI1 Gene-Disease associations (from GenCC):

• Smith-Magenis syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet
• Potocki-Lupski syndrome

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics

ACMG classification

Our verdict: Benign. The variant received -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_030665.4
• BP6: Variant 17-17793779-CCAGCAGCAGCAGCAGCAGCAGCAG-C is Benign according to our data. Variant chr17-17793779-CCAGCAGCAGCAGCAGCAGCAGCAG-C is described in ClinVar as Likely_benign. ClinVar VariationId is 1512341.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population amr. GnomAdExome4 allele frequency = 0.0000321 (41/1278812) while in subpopulation AMR AF = 0.000347 (11/31712). AF 95% confidence interval is 0.000194. There are 0 homozygotes in GnomAdExome4. There are 21 alleles in the male GnomAdExome4 subpopulation. This position passed quality control check.
• BS2: High AC in GnomAdExome4 at 41 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_030665.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RAI1	NM_030665.4	MANE Select	c.849_872delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln284_Gln291del	disruptive_inframe_deletion	Exon 3 of 6	NP_109590.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RAI1	ENST00000353383.6	TSL:1 MANE Select	c.849_872delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln284_Gln291del	disruptive_inframe_deletion	Exon 3 of 6	ENSP00000323074.4	Q7Z5J4-1
	RAI1	ENST00000918590.1		c.849_872delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln284_Gln291del	disruptive_inframe_deletion	Exon 2 of 5	ENSP00000588649.1
	RAI1	ENST00000955422.1		c.849_872delGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln284_Gln291del	disruptive_inframe_deletion	Exon 3 of 6	ENSP00000625481.1

Frequencies

GnomAD3 genomes AF: 0.0000254 AC: 2 AN: 78832 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000842

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000321 AC: 41 AN: 1278812 Hom.: 0 AF XY: 0.0000332 AC XY: 21 AN XY: 632490

African (AFR) AF: 0.00 AC: 0 AN: 28608

American (AMR) AF: 0.000347 AC: 11 AN: 31712

Ashkenazi Jewish (ASJ) AF: 0.0000428 AC: 1 AN: 23378

East Asian (EAS) AF: 0.0000537 AC: 1 AN: 18624

South Asian (SAS) AF: 0.0000179 AC: 1 AN: 55806

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 46186

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4866

European-Non Finnish (NFE) AF: 0.0000265 AC: 27 AN: 1017670

Other (OTH) AF: 0.00 AC: 0 AN: 51962

GnomAD4 genome AF: 0.0000254 AC: 2 AN: 78832 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 37424

African (AFR) AF: 0.0000842 AC: 2 AN: 23752

American (AMR) AF: 0.00 AC: 0 AN: 5872

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 1968

East Asian (EAS) AF: 0.00 AC: 0 AN: 750

South Asian (SAS) AF: 0.00 AC: 0 AN: 816

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6066

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 178

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 37988

Other (OTH) AF: 0.00 AC: 0 AN: 1062

Alfa AF: 0.00 Hom.: 2

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	Intellectual disability (1)
-	1	-	RAI1-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.9
Mutation Taster		=132/68	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs371983878; hg19: chr17-17697093;