17-17793779-CCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr17-17793779-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs371983878
• NM_030665.4:c.846_872dupGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_030665.4(RAI1):​c.846_872dupGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln283_Gln291dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000147 in 1,357,644 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars). Synonymous variant affecting the same amino acid position (i.e. Q291Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 0)
  • Exomes 𝑓: 7.8e-7 (0 hom.)
• Consequence: RAI1 NM_030665.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 1.36
• Publications: 8 publications found

Genes affected

RAI1 (HGNC:9834): (retinoic acid induced 1) This gene is located within the Smith-Magenis syndrome region on chromosome 17. It is highly similar to its mouse counterpart and is expressed at high levels mainly in neuronal tissues. The protein encoded by this gene includes a polymorphic polyglutamine tract in the N-terminal domain. Expression of the mouse counterpart in neurons is induced by retinoic acid. This gene is associated with both the severity of the phenotype and the response to medication in schizophrenic patients. [provided by RefSeq, Jul 2008]

RAI1 Gene-Disease associations (from GenCC):

• Smith-Magenis syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), G2P
• Potocki-Lupski syndrome

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_030665.4

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RAI1	NM_030665.4	c.846_872dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln283_Gln291dup	disruptive_inframe_insertion	Exon 3 of 6	ENST00000353383.6	NP_109590.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RAI1	ENST00000353383.6	c.846_872dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln283_Gln291dup	disruptive_inframe_insertion	Exon 3 of 6	1	NM_030665.4	ENSP00000323074.4
RAI1	ENST00000395774.1	c.846_872dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln283_Gln291dup	disruptive_inframe_insertion	Exon 2 of 2	2		ENSP00000379120.1

Frequencies

GnomAD3 genomes AF: 0.0000127 AC: 1 AN: 78832 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000263

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 7.82e-7 AC: 1 AN: 1278812 Hom.: 0 Cov.: 38 AF XY: 0.00 AC XY: 0 AN XY: 632490

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 28608

American (AMR) AF: 0.00 AC: 0 AN: 31712

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23378

East Asian (EAS) AF: 0.00 AC: 0 AN: 18624

South Asian (SAS) AF: 0.00 AC: 0 AN: 55806

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 46186

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4866

European-Non Finnish (NFE) AF: 9.83e-7 AC: 1 AN: 1017670

Other (OTH) AF: 0.00 AC: 0 AN: 51962

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000127 AC: 1 AN: 78832 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 37424

African (AFR) AF: 0.00 AC: 0 AN: 23752

American (AMR) AF: 0.00 AC: 0 AN: 5872

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 1968

East Asian (EAS) AF: 0.00 AC: 0 AN: 750

South Asian (SAS) AF: 0.00 AC: 0 AN: 816

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6066

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 178

European-Non Finnish (NFE) AF: 0.0000263 AC: 1 AN: 37988

Other (OTH) AF: 0.00 AC: 0 AN: 1062

Alfa AF: 0.00 Hom.: 2

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

not provided Uncertain:1

Sep 16, 2018

Gharavi Laboratory, Columbia University

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=83/17	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs371983878; hg19: chr17-17697093;