17-42118011-ACTGAAGCTGAGGAGAGAGAGAGACGTCAGGGATGGGGGG-A

Variant names:

• chr17-42118011-ACTGAAGCTGAGGAGAGAGAGAGACGTCAGGGATGGGGGG-A
• rs781885483
• NM_021078.3:c.1181-33_1186delCCCCCCATCCCTGACGTCTCTCTCTCTCCTCAGCTTCAG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 2P and 10B. PVS1_Moderate BP6_Moderate BA1

The NM_021078.3(KAT2A):​c.1181-33_1186delCCCCCCATCCCTGACGTCTCTCTCTCTCCTCAGCTTCAG​(p.Ala394_Ser395del) variant causes a splice acceptor, disruptive inframe deletion, splice region, intron change. The variant allele was found at a frequency of 0.0297 in 141,280 control chromosomes in the GnomAD database, including 144 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.030 (144 hom., cov: 31)
  • Exomes 𝑓: 0.032 (2059 hom.)
  • Failed GnomAD Quality Control
• Consequence: KAT2A NM_021078.3 splice_acceptor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 5.25

Genes affected

KAT2A (HGNC:4201): (lysine acetyltransferase 2A) KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]).[supplied by OMIM, Sep 2009]

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.044152744 fraction of the gene. Cryptic splice site detected, with MaxEntScore 12, offset of 0 (no position change), new splice context is: ttctctctctctctcctcAGctt. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• BP6: Variant 17-42118011-ACTGAAGCTGAGGAGAGAGAGAGACGTCAGGGATGGGGGG-A is Benign according to our data. Variant chr17-42118011-ACTGAAGCTGAGGAGAGAGAGAGACGTCAGGGATGGGGGG-A is described in ClinVar as [Benign]. Clinvar id is 775163.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr17-42118011-ACTGAAGCTGAGGAGAGAGAGAGACGTCAGGGATGGGGGG-A is described in Lovd as [Likely_benign].
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.0775 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KAT2A	NM_021078.3	c.1181-33_1186delCCCCCCATCCCTGACGTCTCTCTCTCTCCTCAGCTTCAG	p.Ala394_Ser395del	splice_acceptor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 8 of 18	ENST00000225916.10	NP_066564.2
KAT2A	NM_001376227.1	c.1181-33_1186delCCCCCCATCCCTGACGTCTCTCTCTCTCCTCAGCTTCAG	p.Ala394_Ser395del	splice_acceptor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 8 of 18		NP_001363156.1
KAT2A	XM_006721818.5	c.98-33_103delCCCCCCATCCCTGACGTCTCTCTCTCTCCTCAGCTTCAG	p.Ala33_Ser34del	splice_acceptor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 3 of 13		XP_006721881.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KAT2A	ENST00000225916.10	c.1181-33_1186delCCCCCCATCCCTGACGTCTCTCTCTCTCCTCAGCTTCAG	p.Ala394_Ser395del	splice_acceptor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 8 of 18	1	NM_021078.3	ENSP00000225916.5
KAT2A	ENST00000465682.5	n.*295-33_*300delCCCCCCATCCCTGACGTCTCTCTCTCTCCTCAGCTTCAG		splice_region_variant, non_coding_transcript_exon_variant	Exon 8 of 18	5		ENSP00000468390.1
KAT2A	ENST00000465682.5	n.*295-33_*300delCCCCCCATCCCTGACGTCTCTCTCTCTCCTCAGCTTCAG		splice_acceptor_variant, splice_region_variant, 3_prime_UTR_variant, intron_variant	Exon 8 of 18	5		ENSP00000468390.1

Frequencies

GnomAD3 genomes AF: 0.0296 AC: 4176 AN: 141172 Hom.: 141 Cov.: 31

Gnomad AFR AF: 0.0799

Gnomad AMI AF: 0.0102

Gnomad AMR AF: 0.0159

Gnomad ASJ AF: 0.0367

Gnomad EAS AF: 0.0121

Gnomad SAS AF: 0.0295

Gnomad FIN AF: 0.0142

Gnomad MID AF: 0.0357

Gnomad NFE AF: 0.0122

Gnomad OTH AF: 0.0279

GnomAD2 exomes AF: 0.0416 AC: 9143 AN: 219986 AF XY: 0.0425

Gnomad AFR exome AF: 0.0913

Gnomad AMR exome AF: 0.0249

Gnomad ASJ exome AF: 0.0386

Gnomad EAS exome AF: 0.0106

Gnomad FIN exome AF: 0.0337

Gnomad NFE exome AF: 0.0457

Gnomad OTH exome AF: 0.0417

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0324 AC: 46288 AN: 1429614 Hom.: 2059 AF XY: 0.0321 AC XY: 22748 AN XY: 708512

Gnomad4 AFR exome AF: 0.0822 AC: 2630 AN: 32010

Gnomad4 AMR exome AF: 0.0142 AC: 594 AN: 41846

Gnomad4 ASJ exome AF: 0.0382 AC: 938 AN: 24542

Gnomad4 EAS exome AF: 0.0215 AC: 845 AN: 39348

Gnomad4 SAS exome AF: 0.0350 AC: 2891 AN: 82540

Gnomad4 FIN exome AF: 0.0175 AC: 920 AN: 52592

Gnomad4 NFE exome AF: 0.0322 AC: 35205 AN: 1092246

Gnomad4 Remaining exome AF: 0.0339 AC: 1997 AN: 58878

GnomAD4 genome AF: 0.0297 AC: 4201 AN: 141280 Hom.: 144 Cov.: 31 AF XY: 0.0295 AC XY: 2038 AN XY: 69082

Gnomad4 AFR AF: 0.0800 AC: 0.0800323 AN: 0.0800323

Gnomad4 AMR AF: 0.0159 AC: 0.0158836 AN: 0.0158836

Gnomad4 ASJ AF: 0.0367 AC: 0.0367477 AN: 0.0367477

Gnomad4 EAS AF: 0.0123 AC: 0.0122772 AN: 0.0122772

Gnomad4 SAS AF: 0.0300 AC: 0.0299658 AN: 0.0299658

Gnomad4 FIN AF: 0.0142 AC: 0.0142387 AN: 0.0142387

Gnomad4 NFE AF: 0.0123 AC: 0.0122585 AN: 0.0122585

Gnomad4 OTH AF: 0.0325 AC: 0.0325123 AN: 0.0325123

Alfa AF: 0.0248 Hom.: 32

Asia WGS AF: 0.0640 AC: 222 AN: 3478

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Aug 28, 2018

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
Mutation Taster		=142/58	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs781885483; hg19: chr17-40270029; COSMIC: COSV56789696; COSMIC: COSV56789696;