17-59620183-GGCCCGGGCTGGTGAGGGCTGT-G

Variant names:

• chr17-59620183-GGCCCGGGCTGGTGAGGGCTGT-G
• NM_004859.4:c.42+12_42+32delCCCGGGCTGGTGAGGGCTGTG

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2 BP6_Moderate

The NM_004859.4(CLTC):​c.42+12_42+32delCCCGGGCTGGTGAGGGCTGTG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,812 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: CLTC NM_004859.4 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 3.26

Genes affected

CLTC (HGNC:2092): (clathrin heavy chain) Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 17-59620183-GGCCCGGGCTGGTGAGGGCTGT-G is Benign according to our data. Variant chr17-59620183-GGCCCGGGCTGGTGAGGGCTGT-G is described in ClinVar as [Likely_benign]. Clinvar id is 1491110.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CLTC	NM_004859.4	c.42+12_42+32delCCCGGGCTGGTGAGGGCTGTG		intron_variant	Intron 1 of 31	ENST00000269122.8	NP_004850.1
CLTC	NM_001288653.2	c.42+12_42+32delCCCGGGCTGGTGAGGGCTGTG		intron_variant	Intron 1 of 31		NP_001275582.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CLTC	ENST00000269122.8	c.42+12_42+32delCCCGGGCTGGTGAGGGCTGTG		intron_variant	Intron 1 of 31	1	NM_004859.4	ENSP00000269122.3

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1461812 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727202

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000270

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Feb 17, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-57697544;