17-61456542-GGCCCAGCGCTCGGAGAGGCCA-G
Variant summary
Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PM4BS2
The NM_001321120.2(TBX4):c.55_75delCCAGCGCTCGGAGAGGCCAGC(p.Pro19_Ser25del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000121 in 1,405,018 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001321120.2 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -2 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TBX4 | ENST00000644296.1 | c.55_75delCCAGCGCTCGGAGAGGCCAGC | p.Pro19_Ser25del | conservative_inframe_deletion | Exon 2 of 9 | NM_001321120.2 | ENSP00000495986.1 | |||
TBX4 | ENST00000240335.1 | c.55_75delCCAGCGCTCGGAGAGGCCAGC | p.Pro19_Ser25del | conservative_inframe_deletion | Exon 1 of 8 | 1 | ENSP00000240335.1 | |||
TBX4 | ENST00000642491.1 | c.55_75delCCAGCGCTCGGAGAGGCCAGC | p.Pro19_Ser25del | conservative_inframe_deletion | Exon 1 of 8 | ENSP00000495714.1 | ||||
TBX4 | ENST00000589003.5 | c.-125-79_-125-59delCCAGCGCTCGGAGAGGCCAGC | intron_variant | Intron 1 of 5 | 3 | ENSP00000467588.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.0000121 AC: 17AN: 1405018Hom.: 0 AF XY: 0.0000101 AC XY: 7AN XY: 693834
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
not provided Uncertain:1
This variant, c.55_75del, results in the deletion of 7 amino acid(s) of the TBX4 protein (p.Pro19_Ser25del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.002%). This variant has not been reported in the literature in individuals affected with TBX4-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at