17-61456542-GGCCCAGCGCTCGGAGAGGCCA-G

Variant names:

• chr17-61456542-GGCCCAGCGCTCGGAGAGGCCA-G
• rs1456954040
• NM_001321120.2:c.55_75delCCAGCGCTCGGAGAGGCCAGC

Variant summary

Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PM4 BS2

The NM_001321120.2(TBX4):​c.55_75delCCAGCGCTCGGAGAGGCCAGC​(p.Pro19_Ser25del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000121 in 1,405,018 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.000012 (0 hom.)
• Consequence: TBX4 NM_001321120.2 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.07

Genes affected

TBX4 (HGNC:11603): (T-box transcription factor 4) This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human homolog of mouse Tbx4, which is closely linked to Tbx2 on mouse chromosome 11. Similarly this gene, like TBX2, maps to human chromosome 17. Expression studies in mouse and chicken show that Tbx4 is expressed in developing hindlimb, but not in forelimb buds, suggesting a role for this gene in regulating limb development and specification of limb identity. [provided by RefSeq, Jul 2008]

LOC124904042 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001321120.2.
• BS2: High AC in GnomAdExome4 at 17 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TBX4	NM_001321120.2	c.55_75delCCAGCGCTCGGAGAGGCCAGC	p.Pro19_Ser25del	conservative_inframe_deletion	Exon 2 of 9	ENST00000644296.1	NP_001308049.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TBX4	ENST00000644296.1	c.55_75delCCAGCGCTCGGAGAGGCCAGC	p.Pro19_Ser25del	conservative_inframe_deletion	Exon 2 of 9		NM_001321120.2	ENSP00000495986.1
TBX4	ENST00000240335.1	c.55_75delCCAGCGCTCGGAGAGGCCAGC	p.Pro19_Ser25del	conservative_inframe_deletion	Exon 1 of 8	1		ENSP00000240335.1
TBX4	ENST00000642491.1	c.55_75delCCAGCGCTCGGAGAGGCCAGC	p.Pro19_Ser25del	conservative_inframe_deletion	Exon 1 of 8			ENSP00000495714.1
TBX4	ENST00000589003.5	c.-125-79_-125-59delCCAGCGCTCGGAGAGGCCAGC		intron_variant	Intron 1 of 5	3		ENSP00000467588.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.0000121 AC: 17 AN: 1405018 Hom.: 0 AF XY: 0.0000101 AC XY: 7 AN XY: 693834

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000157

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Jan 19, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.55_75del, results in the deletion of 7 amino acid(s) of the TBX4 protein (p.Pro19_Ser25del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.002%). This variant has not been reported in the literature in individuals affected with TBX4-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1456954040; hg19: chr17-59533903;