17-63477113-C-CGCCGGGGGCCGGGGCTGCTGCTGCCGCT

Variant names:

• chr17-63477113-C-CGCCGGGGGCCGGGGCTGCTGCTGCCGCT
• NM_000789.4:c.24_51dupGGGGCCGGGGCTGCTGCTGCCGCTGCCG

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_000789.4(ACE):​c.24_51dupGGGGCCGGGGCTGCTGCTGCCGCTGCCG​(p.Leu18GlyfsTer34) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: ACE NM_000789.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.215

Genes affected

ACE (HGNC:2707): (angiotensin I converting enzyme) This gene encodes an enzyme involved in blood pressure regulation and electrolyte balance. It catalyzes the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This angiotensin converting enzyme (ACE) also inactivates the vasodilator protein, bradykinin. Accordingly, the encoded enzyme increases blood pressure and is a drug target of ACE inhibitors, which are often prescribed to reduce blood pressure. This enzyme additionally plays a role in fertility through its ability to cleave and release GPI-anchored membrane proteins in spermatozoa. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme. This polymorphism, as well as mutations in this gene, have been implicated in a wide variety of diseases including cardiovascular pathophysiologies, psoriasis, renal disease, stroke, and Alzheimer's disease. Regulation of the homologous ACE2 gene may be involved in progression of disease caused by several human coronaviruses, including SARS-CoV and SARS-CoV-2. Alternative splicing results in multiple transcript variants encoding both somatic (sACE) and male-specific testicular (tACE) isoforms. [provided by RefSeq, Sep 2020]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 17 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-63477113-C-CGCCGGGGGCCGGGGCTGCTGCTGCCGCT is Pathogenic according to our data. Variant chr17-63477113-C-CGCCGGGGGCCGGGGCTGCTGCTGCCGCT is described in ClinVar as [Likely_pathogenic]. Clinvar id is 3582407.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ACE	NM_000789.4	c.24_51dupGGGGCCGGGGCTGCTGCTGCCGCTGCCG	p.Leu18GlyfsTer34	frameshift_variant	Exon 1 of 25	ENST00000290866.10	NP_000780.1
ACE	NM_001382700.1	c.-212_-185dupGGGGCCGGGGCTGCTGCTGCCGCTGCCG		5_prime_UTR_variant	Exon 1 of 22		NP_001369629.1
ACE	NM_001382701.1	c.-591_-564dupGGGGCCGGGGCTGCTGCTGCCGCTGCCG		5_prime_UTR_variant	Exon 1 of 23		NP_001369630.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ACE	ENST00000290866.10	c.24_51dupGGGGCCGGGGCTGCTGCTGCCGCTGCCG	p.Leu18GlyfsTer34	frameshift_variant	Exon 1 of 25	1	NM_000789.4	ENSP00000290866.4

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 28

GnomAD4 genome Cov.: 31

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Microvascular complications of diabetes, susceptibility to, 3;C3281105:Hemorrhage, intracerebral, susceptibility to;C5681536:Renal tubular dysgenesis of genetic origin Pathogenic:1

Jun 17, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-61554474;